Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-153-3p URS0000068B85_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 6 databases (PirBase, ENA, miRBase, RefSeq, MirGeneDB, TarBase). Mus musculus (house mouse) mmu-miR-153-3p sequence is a product of miR-153, mmu-miR-153, Mir153, miR-153-3p, mmu-miR-153-3p genes. Found in the house mouse reference genome. Interacts with protein-coding genes, including 0610010I23Rik, 0610013I17Rik, 0610030E20Rik, 0710001F19Rik, 1110001K16Rik, 1110003E12Rik, 1110003F05Rik, 1110003O22Rik, 1110005L02Rik, 1110005P14Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUGCAUAGUCACAAAAGUGAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 55 other species

    1. Alligator mississippiensis (American alligator) ami-miR-153-3p
    2. Anolis carolinensis (green anole) Aca-Mir-153-P2_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-153
    4. Callithrix jacchus cja-miR-153
    5. Callorhinchus milii (elephant shark) Cmi-Mir-153-P2_3p (mature (guide))
    6. Canis lupus familiaris (dog) Cfa-Mir-153-P2_3p (mature (guide))
    7. Capitella teleta cte-miR-153
    8. Capra hircus chi-miR-153
    9. Cavia porcellus cpo-miR-153-3p
    10. Chrysemys picta bellii Cpi-Mir-153-P1_3p (mature (guide))
    11. Columba livia cli-miR-153a-3p
    12. Crassostrea gigas (Pacific oyster) Cgi-Mir-153_3p (mature (guide))
    13. Danio rerio (zebrafish) dre-miR-153a-3p
    14. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-153-P1_3p (mature (guide))
    15. Echinops telfairi Ete-Mir-153-P1_3p (mature (guide))
    16. Eptatretus burgeri Ebu-Mir-153-P7_3p (mature (guide))
    17. Equus caballus eca-miR-153
    18. Euprymna scolopes Esc-Mir-153-P18b_3p (mature (guide))
    19. Gadus morhua Gmo-Mir-153-P1b_3p (mature (guide))
    20. Gallus gallus (chicken) Gga-Mir-153-P2_3p (mature (guide))
    21. Gekko japonicus Gja-Mir-153-P2_3p (mature (guide))
    22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-153a
    23. Homo sapiens (human) hsa-miR-153-3p
    24. Latimeria chalumnae (coelacanth) Lch-Mir-153-P2_3p (mature (guide))
    25. Lepisosteus oculatus (spotted gar) Loc-Mir-153-P2_3p (mature (guide))
    26. Lingula anatina Lan-Mir-153_3p (mature (guide))
    27. Lottia gigantea (owl limpet) lgi-miR-153
    28. Macaca mulatta Mml-Mir-153-P2_3p (mature (guide))
    29. Maylandia zebra (zebra mbuna) mze-miR-153a
    30. Melibe leonina mle-miR-153-3p
    31. Microcaecilia unicolor Mun-Mir-153-P1_3p (mature (guide))
    32. Monodelphis domestica mdo-miR-153-3p
    33. Monopterus albus (swamp eel) Mal-Mir-153-P1b_3p (mature (guide))
    34. Nautilus pompilius Npo-Mir-153_3p (mature (guide))
    35. Neolamprologus brichardi nbr-miR-153a
    36. Octopus bimaculoides Obi-Mir-153_3p (mature (guide))
    37. Octopus vulgaris (common octopus) Ovu-Mir-153_3p (mature (guide))
    38. Oreochromis niloticus (Nile tilapia) oni-miR-153a
    39. Ornithorhynchus anatinus oan-miR-153-3p
    40. Oryctolagus cuniculus (rabbit) Ocu-Mir-153-P1_3p (mature (guide))
    41. Pan troglodytes ptr-miR-153
    42. Pongo pygmaeus (Bornean orangutan) ppy-miR-153
    43. Pundamilia nyererei pny-miR-153a
    44. Python bivittatus (Burmese python) Pbv-Mir-153-P2_3p (mature (guide))
    45. Rattus norvegicus rno-miR-153-3p
    46. Salmo salar (Atlantic salmon) ssa-miR-153b-3p
    47. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-153-P2_3p (mature (guide))
    48. Scyliorhinus torazame Sto-Mir-153-P2_3p (mature (guide))
    49. Sphenodon punctatus Spt-Mir-153-P2_3p (mature (guide))
    50. Taeniopygia guttata (zebra finch) tgu-miR-153-3p
    51. Takifugu rubripes (torafugu) fru-miR-153a
    52. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-153a
    53. Tor tambroides miR-153a-3p
    54. Xenopus laevis Xla-Mir-153-P2c_3p (mature (guide))
    55. Xenopus tropicalis Xtr-Mir-153-P2_3p (mature (guide))
    Publications New