Oryctolagus cuniculus (rabbit) ocu-miR-485-3p URS000006372A_9986

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 11 other species
• 19 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

GUCAUACACGGCUCUCCUCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

1. Cervus elaphus cel-miR-485-3p
2. Dasypus novemcinctus dno-miR-485-3p
3. Eptesicus fuscus (big brown bat) efu-miR-485
4. Equus caballus (horse) eca-miR-485-3p
5. Homo sapiens (human) hsa-miR-485-3p
6. Macaca mulatta (Rhesus monkey) mml-miR-485-3p
7. Mus musculus Mus_musculus piRNA piR-mmu-33733938
8. Ovis aries (sheep) oar-miR-485-3p
9. Pan troglodytes ptr-miR-485
10. Pongo pygmaeus ppy-miR-485-3p
11. Pteropus alecto (black flying fox) pal-miR-485-3p

Publications Download

• FASTA
• JSON