Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-485-3p URS000006372A_9796

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCAUACACGGCUCUCCUCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Cervus elaphus cel-miR-485-3p
  2. Dasypus novemcinctus dno-miR-485-3p
  3. Eptesicus fuscus (big brown bat) efu-miR-485
  4. Homo sapiens (human) hsa-miR-485-3p
  5. Macaca mulatta (Rhesus monkey) mml-miR-485-3p
  6. Mus musculus Mus_musculus piRNA piR-mmu-33733938
  7. Oryctolagus cuniculus ocu-miR-485-3p
  8. Ovis aries (sheep) oar-miR-485-3p
  9. Pan troglodytes ptr-miR-485
  10. Pongo pygmaeus ppy-miR-485-3p
  11. Pteropus alecto (black flying fox) pal-miR-485-3p
Publications