Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-485-3p URS000006372A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-485: Hsa-mir-485 is a microRNA that has been found to be involved in various biological processes and diseases [PMC6718473]. It has been shown that hsa-mir-485 is induced in human embryonic kidney (HEK) 293T cells in response to Newcastle disease virus (NDV) infection, and it targets RIG-I mRNA, leading to the suppression of the antiviral response and enhanced replication of NDV [PMC6718473]. In Alzheimer's disease (AD), hsa-mir-485 is one of the 30 differentially regulated miRNAs found in the brain and blood of AD patients, with 10 miRNAs associated with Braak stage III [PMC6497742]. Furthermore, hsa-mir-485 is one of the miRNAs that are downregulated in glioblastoma (GBM) but upregulated in AD [PMC6682788]. Pathway prediction analysis has shown that hsa-mir-485 can interact with the AD pathway and target different genes [PMC6682788]. Expression data for hsa-mir-485 has been observed in the cerebellum and adrenal gland [PMC5635130]. In summary, hsa-mir-485 plays a role in NDV infection, AD, GBM, and potentially regulates various biological mechanisms through its interaction with different genes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCAUACACGGCUCUCCUCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Cervus elaphus cel-miR-485-3p
  2. Dasypus novemcinctus (nine-banded armadillo) dno-miR-485-3p
  3. Eptesicus fuscus efu-miR-485
  4. Equus caballus eca-miR-485-3p
  5. Macaca mulatta (Rhesus monkey) mml-miR-485-3p
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-33733938
  7. Oryctolagus cuniculus ocu-miR-485-3p
  8. Ovis aries oar-miR-485-3p
  9. Pan troglodytes ptr-miR-485
  10. Pongo pygmaeus (Bornean orangutan) ppy-miR-485-3p
  11. Pteropus alecto pal-miR-485-3p
Publications