Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Staphylococcus aureus subsp. aureus N315 5S ribosomal RNA secondary structure diagram

Staphylococcus aureus subsp. aureus N315 5S ribosomal RNA URS0000062A7E_158879

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGGUGACUAUAGCAAGGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCCUUAGCGUCGAUGGUAGUCGAACUUACGUUCCGCUAGAGUAGAACGUUGCCAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 153 other species

  1. Staphylococcus aureus subsp. aureus NCTC 8325 5S ribosomal RNA from Staphylococcus aureus subsp. aureus NCTC 8325 (PDB 6SJ6, chain B)
  2. Acinetobacter baumannii 5S ribosomal RNA
  3. Allobacillus halotolerans 5S ribosomal RNA
  4. Bacillus subtilis subsp. subtilis 5S ribosomal RNA
  5. Enterobacter sp. 50858885 5S ribosomal RNA
  6. Enterococcus faecium 5S ribosomal RNA
  7. Escherichia coli 5S ribosomal RNA
  8. Klebsiella oxytoca 5S ribosomal RNA
  9. Klebsiella pneumoniae 5S ribosomal RNA
  10. Klebsiella pneumoniae subsp. pneumoniae 5S ribosomal RNA
  11. Legionella pneumophila 5S ribosomal RNA
  12. Pantoea vagans 5S ribosomal RNA
  13. Enemella evansiae 5S ribosomal RNA
  14. Pseudomonas aeruginosa 5S ribosomal RNA
  15. Serratia marcescens 5S ribosomal RNA
  16. Staphylococcus argenteus 5S rRNA
  17. Staphylococcus aureus 04-02981 5S Ribosomal RNA
  18. Staphylococcus aureus 5S rRNA
  19. Staphylococcus aureus CI11 5S ribosomal RNA
  20. Staphylococcus aureus LAC 5S ribosomal RNA
  21. Staphylococcus aureus M1057 5S ribosomal RNA
  22. Staphylococcus aureus M1 5S RNA
  23. Staphylococcus aureus MRSA_CVM43477 5S ribosomal RNA
  24. Staphylococcus aureus MRSA_CVMN25720PS 5S ribosomal RNA
  25. Staphylococcus aureus MRSA_CVMN26035PS 5S ribosomal RNA
  26. Staphylococcus aureus MRSA_CVMN27231PS 5S ribosomal RNA
  27. Staphylococcus aureus MRSN 2761 5S ribosomal RNA
  28. Staphylococcus aureus MRSN 8611 5S ribosomal RNA
  29. Staphylococcus aureus MRSN 8613 5S ribosomal RNA
  30. Staphylococcus aureus MUF168 5S ribosomal RNA
  31. Staphylococcus aureus MUF256 5S ribosomal RNA
  32. Staphylococcus aureus MUM270 5S ribosomal RNA
  33. Staphylococcus aureus MUM475 5S ribosomal RNA
  34. Staphylococcus aureus O46 5S ribosomal RNA
  35. Staphylococcus aureus RF122 5S ribosomal RNA
  36. Staphylococcus aureus S100 5S ribosomal RNA
  37. Staphylococcus aureus S123 5S ribosomal RNA
  38. Staphylococcus aureus S130 5S ribosomal RNA
  39. Staphylococcus aureus S1 5S ribosomal RNA
  40. Staphylococcus aureus S94 5S ribosomal RNA
  41. Staphylococcus aureus SA16 5S ribosomal RNA
  42. Staphylococcus aureus SA_ST125_MupR 5S ribosomal RNA
  43. Staphylococcus aureus subsp. anaerobius 5S ribosomal RNA
  44. Staphylococcus aureus subsp. aureus 21178 5S ribosomal RNA
  45. Staphylococcus aureus subsp. aureus 21189 5S ribosomal RNA
  46. Staphylococcus aureus subsp. aureus 21193 5S ribosomal RNA
  47. Staphylococcus aureus subsp. aureus 21194 5S ribosomal RNA
  48. Staphylococcus aureus subsp. aureus 21195 5S ribosomal RNA
  49. Staphylococcus aureus subsp. aureus 21196 5S ribosomal RNA
  50. Staphylococcus aureus subsp. aureus 21200 5S ribosomal RNA
  51. Staphylococcus aureus subsp. aureus 21201 5S ribosomal RNA
  52. Staphylococcus aureus subsp. aureus 21202 5S ribosomal RNA
  53. Staphylococcus aureus subsp. aureus 21204 5S ribosomal RNA
  54. Staphylococcus aureus subsp. aureus 21209 5S ribosomal RNA
  55. Staphylococcus aureus subsp. aureus 21232 5S ribosomal RNA
  56. Staphylococcus aureus subsp. aureus 21235 5S ribosomal RNA
  57. Staphylococcus aureus subsp. aureus 21259 5S ribosomal RNA
  58. Staphylococcus aureus subsp. aureus 21262 5S ribosomal RNA
  59. Staphylococcus aureus subsp. aureus 21264 5S ribosomal RNA
  60. Staphylococcus aureus subsp. aureus 21269 5S ribosomal RNA
  61. Staphylococcus aureus subsp. aureus 21282 5S ribosomal RNA
  62. Staphylococcus aureus subsp. aureus 21283 5S ribosomal RNA
  63. Staphylococcus aureus subsp. aureus 21305 5S ribosomal RNA
  64. Staphylococcus aureus subsp. aureus 21310 5S ribosomal RNA
  65. Staphylococcus aureus subsp. aureus 21318 5S ribosomal RNA
  66. Staphylococcus aureus subsp. aureus 21331 5S ribosomal RNA
  67. Staphylococcus aureus subsp. aureus 21333 5S ribosomal RNA
  68. Staphylococcus aureus subsp. aureus 21340 5S ribosomal RNA
  69. Staphylococcus aureus subsp. aureus 21342 5S ribosomal RNA
  70. Staphylococcus aureus subsp. aureus 21343 5S ribosomal RNA
  71. Staphylococcus aureus subsp. aureus 21345 5S ribosomal RNA
  72. Staphylococcus aureus subsp. aureus 300-169 5S ribosomal RNA
  73. Staphylococcus aureus subsp. aureus 301-188 5S ribosomal RNA
  74. Staphylococcus aureus subsp. aureus 5S ribosomal RNA
  75. Staphylococcus aureus subsp. aureus 71193 5S ribosomal RNA
  76. Staphylococcus aureus subsp. aureus CBD-635 5S ribosomal RNA
  77. Staphylococcus aureus subsp. aureus CN1 5S ribosomal RNA
  78. Staphylococcus aureus subsp. aureus CO-06 5S ribosomal RNA
  79. Staphylococcus aureus subsp. aureus CO-08 5S ribosomal RNA
  80. Staphylococcus aureus subsp. aureus CO-23 5S ribosomal RNA
  81. Staphylococcus aureus subsp. aureus COL 5S ribosomal RNA
  82. Staphylococcus aureus subsp. aureus DSM 20231 5S ribosomal RNA
  83. Staphylococcus aureus subsp. aureus ED133 5S ribosomal RNA
  84. Staphylococcus aureus subsp. aureus ED98 5S ribosomal RNA
  85. Staphylococcus aureus subsp. aureus HO 5096 0412 5S rRNA
  86. Staphylococcus aureus subsp. aureus IS-105 5S ribosomal RNA
  87. Staphylococcus aureus subsp. aureus IS-111 5S ribosomal RNA
  88. Staphylococcus aureus subsp. aureus IS-122 5S ribosomal RNA
  89. Staphylococcus aureus subsp. aureus IS-125 5S ribosomal RNA
  90. Staphylococcus aureus subsp. aureus IS-157 5S ribosomal RNA
  91. Staphylococcus aureus subsp. aureus IS-160 5S ribosomal RNA
  92. Staphylococcus aureus subsp. aureus IS-189 5S ribosomal RNA
  93. Staphylococcus aureus subsp. aureus IS-24 5S ribosomal RNA
  94. Staphylococcus aureus subsp. aureus IS-3 5S ribosomal RNA
  95. Staphylococcus aureus subsp. aureus IS-55 5S ribosomal RNA
  96. Staphylococcus aureus subsp. aureus IS-88 5S ribosomal RNA
  97. Staphylococcus aureus subsp. aureus IS-91 5S ribosomal RNA
  98. Staphylococcus aureus subsp. aureus IS-99 5S ribosomal RNA
  99. Staphylococcus aureus subsp. aureus IS-M 5S ribosomal RNA
  100. Staphylococcus aureus subsp. aureus JKD6159 5S ribosomal RNA
  101. Staphylococcus aureus subsp. aureus LGA251 ribosomal RNA
  102. Staphylococcus aureus subsp. aureus M013 5S ribosomal RNA
  103. Staphylococcus aureus subsp. aureus MRSA252 ribosomal RNA
  104. Staphylococcus aureus subsp. aureus MRSA_S4 5S ribosomal RNA
  105. Staphylococcus aureus subsp. aureus MSSA476 rRNA
  106. Staphylococcus aureus subsp. aureus Mu3 5S rRNA
  107. Staphylococcus aureus subsp. aureus Mu50 rRNA-5S
  108. Staphylococcus aureus subsp. aureus MW2 5S ribosomal RNA
  109. Staphylococcus aureus subsp. aureus RN4220 5S ribosomal RNA
  110. Staphylococcus aureus subsp. aureus SA268 5S ribosomal RNA
  111. Staphylococcus aureus subsp. aureus SA40 5S ribosomal RNA
  112. Staphylococcus aureus subsp. aureus SA957 5S ribosomal RNA
  113. Staphylococcus aureus subsp. aureus ST398 5S ribosomal RNA
  114. Staphylococcus aureus subsp. aureus str. Newman 5S ribosomal RNA
  115. Staphylococcus aureus subsp. aureus T0131 5S ribosomal RNA
  116. Staphylococcus aureus subsp. aureus Tager 104 5S ribosomal RNA
  117. Staphylococcus aureus subsp. aureus USA300 5S ribosomal RNA
  118. Staphylococcus aureus subsp. aureus USA300_FPR3757 5S ribosomal RNA
  119. Staphylococcus aureus subsp. aureus VC40 5S ribosomal RNA
  120. Staphylococcus aureus subsp. aureus Z172 5S ribosomal RNA
  121. Staphylococcus aureus T40868 5S ribosomal RNA
  122. Staphylococcus aureus USA300-ISMMS1 5S ribosomal RNA
  123. Staphylococcus aureus W31863 5S ribosomal RNA
  124. Staphylococcus aureus W39830 5S ribosomal RNA
  125. Staphylococcus aureus W58485 5S ribosomal RNA
  126. Staphylococcus aureus W85305 5S ribosomal RNA
  127. Staphylococcus epidermidis 5S ribosomal RNA
  128. Staphylococcus roterodami 5S ribosomal RNA
  129. Staphylococcus schweitzeri 5S ribosomal RNA
  130. Staphylococcus sp. 52716 5S ribosomal RNA
  131. Staphylococcus sp. 53017 5S ribosomal RNA
  132. Staphylococcus sp. 6416 5S ribosomal RNA
  133. Staphylococcus sp. 775 5S ribosomal RNA
  134. Staphylococcus sp. EG-SA-10 5S ribosomal RNA
  135. Staphylococcus sp. EG-SA-21 5S ribosomal RNA
  136. Staphylococcus sp. EG-SA-26 5S ribosomal RNA
  137. Staphylococcus sp. EG-SA-8 5S ribosomal RNA
  138. Staphylococcus sp. FR179 5S ribosomal RNA
  139. Staphylococcus sp. HMSC34D01 5S ribosomal RNA
  140. Staphylococcus sp. HMSC66A04 5S ribosomal RNA
  141. Staphylococcus sp. KY49P 5S ribosomal RNA
  142. Staphylococcus sp. MZ1 5S ribosomal RNA
  143. Staphylococcus sp. MZ3 5S ribosomal RNA
  144. Staphylococcus sp. MZ7 5S ribosomal RNA
  145. Staphylococcus sp. MZ8 5S ribosomal RNA
  146. Staphylococcus sp. MZ9 5S ribosomal RNA
  147. Staphylococcus sp. SM3655 5S ribosomal RNA
  148. Staphylococcus sp. SM9054 5S ribosomal RNA
  149. Staphylococcus sp. T93 5S ribosomal RNA
  150. Streptococcus pyogenes 5S ribosomal RNA
  151. Streptomyces sp. SID5475 5S ribosomal RNA
  152. Streptomyces xinghaiensis 5S rRNA
  153. Stutzerimonas nitrititolerans 5S ribosomal RNA
  154. Vibrio cholerae O1 5S ribosomal RNA
  155. Xanthomonas citri pv. citri 5S ribosomal RNA
2D structure