Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan troglodytes (chimpanzee) microRNA ptr-mir-106b precursor secondary structure diagram

Pan troglodytes (chimpanzee) microRNA ptr-mir-106b precursor URS00000600E6_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGCCGGGGCUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCUCCGUGCUACCGCACUGUGGGUACUUGCUGCUCCAGCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-106b precursor
  2. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000025985.3)
  3. Castor canadensis (American beaver) miRNA (ENSCCNG00000007125.1)
  4. Cebus imitator microRNA 106b (ENSCCAG00000014683.1)
  5. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000015516.1)
  6. Chlorocebus sabaeus microRNA 106b (ENSCSAG00000026020.1)
  7. Gorilla gorilla gorilla ggo-mir-106b (ENSGGOG00000031658.2)
  8. Gorilla gorilla (western gorilla) microRNA ggo-mir-106b precursor
  9. Homo sapiens (human) microRNA hsa-mir-106b precursor
  10. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000010833.1)
  11. Nomascus leucogenys microRNA 106b (ENSNLEG00000023974.2)
  12. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-106b precursor
  13. Papio anubis miRNA (ENSPANG00000014575.3)
  14. Physeter catodon microRNA 106b (ENSPCTG00005009726.1)
  15. Piliocolobus tephrosceles miRNA (ENSPTEG00000025919.1)
  16. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000021087.2)
  17. Pongo pygmaeus microRNA ppy-mir-106b precursor
  18. Rhinolophus ferrumequinum microRNA 106b (ENSRFEG00010002858.1)
  19. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000023519.1)
  20. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000001775.1)
  21. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-106b precursor
  22. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000008334.1)
  23. Sciurus vulgaris (Eurasian red squirrel) microRNA 106b (ENSSVLG00005023692.1)
  24. Sus scrofa microRNA 106b (multiple genes)
  25. Theropithecus gelada microRNA 106b (ENSTGEG00000011519.1)
2D structure Publications