Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) microRNA bmo-mir-2794 precursor URS000005AACC_7091

Automated summary: This pre miRNA sequence is 93 nucleotides long and is found in Bombyx mori. Annotated by 3 databases (ENA, miRBase, RefSeq). Described in 4 papers. Bombyx mori (domestic silkworm) microRNA bmo-mir-2794 precursor sequence is a product of Mir2794, 2794, mir-2794 genes. Found in the domestic silkworm reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGGGGCACGCGACUCCGCGCCGAAGUCAAUUGUGAUGCGGUCGGCUUUUUAGGGACCCCGUUCACGGCGACUUUUCGUAGCGAUGCUGCCGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 0 other species

    1. Bombyx mandarina miRNA-2794