Homo sapiens (human) LAMP5 antisense RNA 1 (LAMP5-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) LAMP5 antisense RNA 1 (LAMP5-AS1) URS0000058C9D_9606

1,928 nucleotides
9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, LNCipedia, NONCODE, RefSeq)
Found in 0 other species
20 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LAMP5-AS1: LAMP5-AS1 is a long non-coding RNA (lncRNA) that has been studied for its potential interaction with DOT1L and its impact on histone methyltransferase functions [PMC7302350]. In order to investigate this interaction and its effects, experiments were conducted using truncated mutants of DOT1L or LAMP5-AS1 [PMC7302350]. These experiments aimed to determine the binding capacity of LAMP5-AS1 to DOT1L and its potential influence on the functions of this histone methyltransferase [PMC7302350]. Furthermore, the regulatory role of LAMP5-AS1 in self-renewal and differentiation was confirmed in MLL leukemia cell lines, including MOLM13, THP1, MV4-11, and RS4-11 [PMC7302350]. These cell lines were used to assess the impact of LAMP5-AS1 on cellular processes related to self-renewal and differentiation in the context of leukemia [PMC7302350].

Targeting miRNAs 1 total

According to LncBase, this RNA is targeted by the following miRNAs:

(human) hsa-miR-5100

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAGCUAAUUGACUUUACUUUGCCGGCUCUGUUCUCUGCAAAGAGUGCCCGUCCUCUCUCCCAGUCGCCAAAUCGCUACUCACGGAACAACAUCAGGAGAACUCGAAGUCUGUCGAUGCUGGGGACCCCUCUUCCUUGGAGAUCCAUACUCGCAGUGCCCCGAAUGAGGCCGGCUGUGCUGCUGCAGAGGCCGCCAGAGAGGGAAUCCCUCAAAGUCGCCGCUGGAGUGGGCCGGGGAAGUGUGCGCUGCUCAGGACACAUGGCCCGUGGUCUGUGGUGUUACCUUUGGAUGGCGCGGCGGUAGGUGGGCCUGGUUGCUCAUGGCUCAGUAUCCCUGGGCUGGCCCGCGCGCCCGCUGCGGACUCCAGACUUGACGGCUUCUGCCCGCGGGAAGGAAGAUGCAUUCUACUGUUGGGCGCCUCGCUGCCUGCACCUCUGGCUCGCGAUGUCCUCAACCUGGGAAAGACGUCGGCGCUUUGCACCCGAGUUGGGCUCCUUGGCACAUUCGAGCAGCUGCUCUGGAGAAACAGCAGGAUCUACGGAAGUUUGUACCCACCGCCUCGCCUGCAGCCUCGGGAGUCUCAACCCAAGCCGGCCCGGCCUUGUAGCCCAGAGCAGCAAAGCCACAGCAGGCAACGCGAGCUAACGCGGGUCGCGCGGAGGUCGGGAGCCCAGGCGGCGGAGGCGGCGGCGGCGCAGUUAUUCCCGGGUGACUCUGGGGACUCGUGCAGAUGGGGGACGCCUCCGGCCACGCACUUGGAGCCAGCUGCAGCUCCCGGGAGCCUGGCACUGAUGGAUCGUCUCAUUUCCCAACUUGAUGGGCCGGAACCUGGGAUAGCUGUGCCUGCAGGGAGAGGCAAGACGAAGAAAGUCGUGCAUCCCCUGGGAGGGAGAGGCUGCUUGUCCCUGUCCUGACACCCCACCCCAUGGCUCAGGCUGGAGUCAGAGGGAAUGAGAAGAGUGGGAAGCCAGAGGCUGAGCUUGGCUUCCUAGAAUCUUCCUCCAUCUCAAGAAGUGGAACUCCAACUCCGCUCCAAGGCCUACCUCCUUAGCUGGGUCUUGGAGAUCACUGAACGGAUCUCAAACCUGGGAUCUUAAAGAAUCCCAAAUCUGGGUGCACCUCAGCAGAAUACGUUCUCCCAGACCAGUCUGUCAGGAAAGCCCCAGCUCUCUAGCUGGCCAGGAAACACCACAUGGUUCGGGACAUCUGACAAAGUGCCGUCCAAAAUCCAAAGUGUGGUUCUGAGACCAGUAGCAUCACUGUCCCUUGGAGACUGCAGGAUUGCAGGCCUCAUCCAGCCCUACUGCAUCGGAACGUGCAUCUGAGAGAUAUCCAAGGACUGUGUACAGUCUGGUUGGAGAAGCCCUUGCCCAAUUUACAGAACCUGAGUUUAGCCAUUGACAACCUGUUCAACCCUGUUCCUCCCAGCCUCCUCUUCAUCACCUGUCAAGUGGGAGCUGUUUUGGAGGUCCUGGGGGGCUCUUAUGCACUCCUGAGUGCAUUCAGACCAAUGGAAUCAGAAUCUCUGGUUUGCUGGAGCCUAGGCAGGAGUGUGUGUUUUGGGUGUCUCCAGGUGAUUUUAAUGGCAGCCAGGAAUGACUAGUGUAGAAAUACCCACUUUACAGAUUAGUUAGAUUAGCUAAUCUGUCUAGCCUGGGCAAGACAAUAUGUGCAGUGUUAAGCCCACUGCUCUCUGUAGCCUGAUUCAUUCUGUAGCCUGACAUUCUGUAGCCUGAGUCAUUCUGACUCCAGCAAGUAUGGCCUUGAACCAUACUUAAUUAGCCAAGUAUGGCUAAUCAGCUUCGCUGUGCCUCGGUUUCCUUACCCACAAAAUGAAGUUGAUAAUAGUGCCCACCACAAAGGGUGUUUGUGAGGAUUUAGAAUCAAAUGUUUAAAAUCAAAUUCAAUAAAUAUUAGUUUAUGAGGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications