Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis thaliana (thale-cress) sRNA AT3G55485 URS000005895C_3702

  • 505 nucleotides
  • 4 databases (ENA, Ensembl Plants, RefSeq, TAIR)
  • Found in 1 species
  • ncRNA

Automated summary: This sRNA sequence is 505 nucleotides long and is found in Arabidopsis thaliana. Annotated by 4 databases (TAIR, ENA, Ensembl Plants, RefSeq). Described in 3 papers. Matches 1 Rfam family (snoR125, RF02409). Arabidopsis thaliana (thale-cress) sRNA AT3G55485 sequence is a product of AT3G55485 gene. Found in the thale-cress reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GAUUUUCUUCUGUAUAUGCUUUCCCGAAAAAUGAAUCUGAAAUUUUGUUUUGAAUGAGUUUUUUUCUGGAAUUUAAAAUAUUUGUGGGCGAUGAUUAAAAAGAGAGAGGCUUGAGAGGUGAGUGUGAACAAAACUCUCAUGGGAUGGAGGAAAAAAUUCAAAUCGAAAUCGAAGGAGAAAUACAUUUAAUAAAAUGUUUUUUUUUCCCUUUUUUGAUUUAGGGUUCUUUCUUUCAUACCUUUCCCUCGGUGACGGUCCUUCCAAGUUACACUUGAUAUGAGCCCUUCUACUAUACUUUCGUUUAAUUUUUGUGUUGGAUGUGGUGUUCUUACUUCUUACAAUGAUUCCAUGAAAAUGUCGGUUAAUUUGUAAUAACAAAACUCACACAUGUAAUAUCAGAAUCGACUUCUUUAACAAACAAAAAAAAAUAUCAGAAUCAACUUGGCCAUUCUUUGAAGAAUUGAUAACAAACACAAUCGAUUAAUUUUGAGAGAAACAUUAUCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.