v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2178 (LINC02178) URS00000582B9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02178: LINC02178 is a long non-coding RNA (lncRNA) that has been found to be expressed at higher levels in the high-risk group compared to the low-risk group in a study on breast cancer (BC) [PMC9755502]. It is considered a risk factor with a hazard ratio (HR) value greater than 1 [PMC7467376]. LINC02178 is also included in the prognostic signature of BC, along with six other lncRNAs [PMC9681547]. Its prognostic value has been examined in the external Kaplan-Meier Plotter database [PMC9929186]. LINC02178 has not been previously reported in lung adenocarcinoma (LUAD) or other cancers [PMC8924059]. Additionally, LINC02178 is one of the lncRNAs that were deleted in a study on lung cancer, along with three other lncRNAs and two microRNAs [PMC9822900]. In summary, LINC02178 is an lncRNA that has been found to be expressed at higher levels in high-risk groups and is considered a risk factor for BC. It has also been included in prognostic signatures for BC and its prognostic value has been examined. Furthermore, LINC02178 has not been previously reported in LUAD or other cancers. Additionally, it was found to be deleted along with other lncRNAs and microRNAs in lung cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAUGAAAGAGACUGAGCCCCUAUGAGUGAGGGUGAUGUCAACACAACAGCAGGCACCCUUGGUAACCAAGUCAGCUUCCAUAUUGAUCAGGACUCUUUUGAUUGCAAGAAACCAAACUCGGAUCUUUAUAAAAGCAAAGGUAAUUGACUCAGUCAGAAGCACAUACAGCACGAGAGUUGUAGGCAUGGCUACACUUAAGCCAUCCCUUUAUCUGGCUUUCAUUAGAGCCUCGGCCGCGCCUCUUUUGUGGGAGAGACUUGAGGGAGCCGAGGCAGUUUCCCAGCCGCUGUGAUGUUGCUAAAGAUUAAAAAGGAGCUUUGAAGCUGCACCAGUUCUCUCUGUGCCCCCUCGGUACAGGACCUCAGAAAGACCCAAGCCAUCUGGCAAACCUGACAUAAAGACAAAAUAAAGUGAUUGAAACAGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications