Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-1248 URS0000057A7C_9913

Automated summary: This miRNA sequence is 27 nucleotides long and is found in Bos taurus. Annotated by 2 databases (RefSeq, miRBase). Described in 3 papers. Bos taurus (cattle) bta-miR-1248 sequence is a product of MIR1248-1, bta-miR-1248, miR-1248, MIR1248-2 genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACCUUCUUGUAUAAGCACUGUGCUAAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 8 other species

    1. Homo sapiens hsa-miR-1248
    2. Macaca fascicularis microRNA miR-1248-5p
    3. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-44136275
    4. Pan troglodytes (chimpanzee) ptr-miR-1248
    5. Pongo pygmaeus ppy-miR-1248