Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1248 URS0000057A7C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1248: Hsa-mir-1248 is a miRNA that is considered an oncomiR [PMC7277914]. It has been found to bind to the 3′UTR of the BRCA1 gene, along with hsa-mir-4278 [PMC7277914]. Additionally, the creation of miRNA family binding sites, such as hsa-miR-548, has been observed in the BRCA2 gene [PMC7277914]. The antitumor effect of hsa-mir-1248 can be influenced by the expression of PSMD10, with its suppression or enhancement being achieved by up-regulating or down-regulating PSMD10 expression [PMC9414407]. These findings suggest that hsa-mir-1248 and its interactions with BRCA1 and PSMD10 may play a role in tumorigenesis and tumor suppression. Further research is needed to fully understand the mechanisms and implications of these interactions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCUUCUUGUAUAAGCACUGUGCUAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Publications