Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-2137 URS0000055612_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-2137: Mmu-mir-2137 is a specific microRNA that has been studied in various contexts [PMC4264908]. In one study, the effects of transient microRNA inhibition on the expression of key genes in FDC (follicular dendritic cells) were investigated, including Il6, Ptgs1/2, and Tlr4 [PMC4264908]. The depletion of specific microRNAs, including mmu-mir-2137, was achieved through the transfection of anti-sense LNAs in FL-YB cells [PMC4264908]. Another study focused on the expression levels of different miRNAs after cerebral ischemia-reperfusion. It was found that mmu-mir-2137 was one of the miRNAs whose expression levels were reduced over time [PMC6798056]. Additionally, in a different study, it was observed that mmu-mir-2137 was upregulated after exposure to 3R4F CS (cigarette smoke), and it has been implicated in the regulation of immune responses [PMC7218232]. These findings highlight the involvement and potential significance of mmu-mir-2137 in various biological processes and its potential role as a regulator of gene expression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCGGCGGGAGCCCCAGGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications