v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anopheles merus (Mosquito) tRNA tRNA-Glu secondary structure diagram

Anopheles merus (Mosquito) tRNA tRNA-Glu URS0000054C50_30066

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCCAUAUGGUCUAGUGGCUAGGAUAUCUGGCUUUCACCCAGAAGGCCCGGGUUCGAUUCCCGGUAUGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 98 other species

  1. Aedes aegypti tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 28)
  2. Aedes albopictus (Asian tiger mosquito) tRNA tRNA-Glu
  3. Anastrepha ludens (Mexican fruit fly) transfer RNA glutamic acid (anticodon UUC)
  4. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glutamic acid (anticodon UUC)
  5. Anopheles albimanus (Mosquitos) tRNA-Glu
  6. Anopheles arabiensis (Mosquito) tRNA tRNA-Glu
  7. Anopheles atroparvus tRNA
  8. Anopheles christyi tRNA tRNA-Glu
  9. Anopheles coluzzii (Mosquito) tRNA-Glu for anticodon UUC
  10. Anopheles culicifacies tRNA tRNA-Glu
  11. Anopheles darlingi tRNA ADAC010847
  12. Anopheles dirus tRNA
  13. Anopheles epiroticus tRNA tRNA-Glu
  14. Anopheles farauti (Mosquito) tRNA tRNA-Glu
  15. Anopheles funestus tRNA-Glu for anticodon UUC
  16. Anopheles gambiae tRNA tRNA-Glu
  17. Anopheles gambiae str. PEST tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 9)
  18. Anopheles maculatus tRNA tRNA-Glu
  19. Anopheles melas (Mosquito) tRNA tRNA-Glu
  20. Anopheles minimus (Mosquito) tRNA tRNA-Glu
  21. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Glu
  22. Anopheles sinensis tRNA tRNA-Glu
  23. Anopheles stephensi tRNA tRNA-Glu
  24. Bactrocera dorsalis transfer RNA glutamic acid (anticodon UUC)
  25. Bactrocera latifrons tRNA-Glu
  26. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glutamic acid (anticodon UUC)
  27. Bactrocera oleae (Olive fruit fly) tRNA-Glu
  28. Bactrocera tryoni tRNA-Glu
  29. Ceratitis capitata tRNA-Glu
  30. Chelonus insularis tRNA-Glu
  31. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015264.1
  32. Culex pipiens pallens (Northern house mosquito) transfer RNA glutamic acid (anticodon UUC)
  33. Culex quinquefasciatus tRNA
  34. Drosophila albomicans (Fruit fly) transfer RNA glutamic acid (anticodon UUC)
  35. Drosophila ananassae tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 6)
  36. Drosophila arizonae (Fruit fly) tRNA-Glu
  37. Drosophila biarmipes (Fruit fly) transfer RNA glutamic acid (anticodon UUC)
  38. Drosophila bipectinata (Pomace flies) transfer RNA glutamic acid (anticodon UUC)
  39. Drosophila busckii (Fruit fly) tRNA-Glu
  40. Drosophila elegans (Pomace flies) tRNA-Glu
  41. Drosophila erecta tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 5)
  42. Drosophila eugracilis (Fruit fly) tRNA-Glu
  43. Drosophila ficusphila (Fruit fly) tRNA-Glu
  44. Drosophila grimshawi tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 5)
  45. Drosophila guanche (Fruit fly) tRNA-Glu
  46. Drosophila gunungcola (Fruit fly) transfer RNA glutamic acid (anticodon UUC)
  47. Drosophila hydei (Fruit fly) tRNA-Glu
  48. Drosophila innubila (Fruit fly) tRNA-Glu
  49. Drosophila kikkawai (Pomace flies) transfer RNA glutamic acid (anticodon UUC)
  50. Drosophila mauritiana (Fruit fly) tRNA-Glu
  51. Drosophila melanogaster (fruit fly) transfer RNA:Glutamic acid-TTC 1-1 (multiple genes)
  52. Drosophila miranda (Fruit fly) tRNA-Glu
  53. Drosophila mojavensis tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 6)
  54. Drosophila montana (Pomace flies) transfer RNA glutamic acid (anticodon UUC)
  55. Drosophila nasuta (Pomace flies) transfer RNA glutamic acid (anticodon UUC)
  56. Drosophila navojoa (Fruit fly) tRNA-Glu
  57. Drosophila novamexicana (Pomace flies) tRNA-Glu
  58. Drosophila obscura (Fruit fly) tRNA-Glu
  59. Drosophila persimilis tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 5)
  60. Drosophila pseudoobscura (Fruit fly) tRNA-Glu
  61. Drosophila pseudoobscura pseudoobscura tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 6)
  62. Drosophila rhopaloa (Fruit fly) tRNA-Glu
  63. Drosophila santomea (Fruit fly) tRNA-Glu
  64. Drosophila sechellia tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 5)
  65. Drosophila serrata (Pomace flies) tRNA-Glu
  66. Drosophila simulans tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 5)
  67. Drosophila subobscura (Fruit fly) tRNA-Glu
  68. Drosophila subpulchrella (Fruit fly) tRNA-Glu
  69. Drosophila sulfurigaster albostrigata (Flies) transfer RNA glutamic acid (anticodon UUC)
  70. Drosophila suzukii (Pomace flies) transfer RNA glutamic acid (anticodon UUC)
  71. Drosophila takahashii (Pomace flies) transfer RNA glutamic acid (anticodon UUC)
  72. Drosophila teissieri (Fruit fly) tRNA-Glu
  73. Drosophila tropicalis (Pomace flies) transfer RNA glutamic acid (anticodon UUC)
  74. Drosophila virilis tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 5)
  75. Drosophila willistoni tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 9)
  76. Drosophila yakuba tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 6)
  77. Glossina austeni (Tsetse fly) tRNA tRNA-Glu
  78. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Glu
  79. Glossina fuscipes fuscipes tRNA
  80. Glossina fuscipes (Tsetse fly) tRNA-Glu
  81. Glossina morsitans morsitans tRNA
  82. Glossina pallidipes (Tsetse fly) tRNA tRNA-Glu
  83. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Glu
  84. Hermetia illucens (Black soldier fly) tRNA-Glu
  85. Ignelater luminosus (cucubano) tRNA
  86. Ischnura elegans (Damselflies) tRNA-Glu
  87. Ladona fulva tRNA
  88. Lucilia cuprina (Australian sheep blowfly) tRNA-Glu for anticodon UUC
  89. Lucilia sericata (Common green bottle fly) tRNA-Glu
  90. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011557.1
  91. Malaya genurostris (Mosquitos) transfer RNA glutamic acid (anticodon UUC)
  92. Megaselia scalaris (Coffin fly) tRNA-Glu for anticodon UUC
  93. Musca domestica (House fly) transfer RNA glutamic acid (anticodon UUC)
  94. Myopa tessellatipennis (flies) misc RNA ENSMTEG00005013288.1
  95. Rhagoletis pomonella tRNA-Glu
  96. Scaptodrosophila lebanonensis tRNA
  97. Stomoxys calcitrans (stable fly) transfer RNA glutamic acid (anticodon UUC)
  98. Teleopsis dalmanni (Malaysian stalk-eyed fly) tRNA-Glu
  99. Topomyia yanbarensis (Mosquitos) transfer RNA glutamic acid (anticodon UUC)
  100. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA glutamic acid (anticodon UUC)
  101. Uranotaenia lowii (Mosquitos) transfer RNA glutamic acid (anticodon UUC)
  102. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA glutamic acid (anticodon UUC)
  103. Zeugodacus cucurbitae (Melon fly) transfer RNA glutamic acid (anticodon UUC)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications