Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila simulans dsi-miR-10 URS0000051B62_7240

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCCUGUAGAUCCGAAUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Acyrthosiphon pisum api-miR-10
  2. Anopheles gambiae (African malaria mosquito) aga-miR-10
  3. Apis mellifera (honey bee) ame-miR-10-5p
  4. Bombyx mori bmo-miR-10-5p
  5. Drosophila ananassae dan-miR-10
  6. Drosophila erecta der-miR-10
  7. Drosophila grimshawi dgr-miR-10
  8. Drosophila melanogaster miR-10
  9. Drosophila mojavensis dmo-miR-10
  10. Drosophila persimilis dpe-miR-10
  11. Drosophila pseudoobscura dps-miR-10
  12. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294400_df_nrg
  13. Drosophila sechellia dse-miR-10
  14. Drosophila willistoni dwi-miR-10
  15. Drosophila yakuba dya-miR-10
  16. Mus musculus Mus_musculus piRNA piR-mmu-8092118
  17. Nasonia longicornis nlo-miR-10
  18. Nasonia vitripennis (jewel wasp) nvi-miR-10
  19. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3376139