Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-2796-3p URS000004B10C_7091

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAGGCCGGCGGAAACUACUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Aedes aegypti Aae-Mir-2796_3p (mature (guide))
  2. Anopheles gambiae aga-miR-2796-3p
  3. Apis mellifera ame-miR-2796-3p
  4. Blattella germanica (German cockroach) Bge-Mir-2796_3p (mature (guide))
  5. Dinoponera quadriceps dqu-miR-2796-3p
  6. Heliconius melpomene (postman butterfly) hme-miR-2796
  7. Manduca sexta mse-miR-2796
  8. Polistes canadensis pca-miR-2796-3p
  9. Tribolium castaneum tca-miR-2796-3p
Publications