Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-31-3p URS000004A408_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-31: bmo-mir-31 is a conserved miRNA that is highly abundant [PMC3699532]. It is expressed in larva and pupa but not detected in moth [PMC2435238]. It shows a similar expression pattern to bmo-miR-71 and bmo-miR-77, with higher expression at the non-larval stage (NLS) and at the molting larval stage (MLS) [PMC2500172]. The higher expression of bmo-mir-31 at MLS suggests its involvement in controlling epithelial metabolism during molting [PMC2500172]. The homolog of bmo-mir-31, dme-miR-31a, is expressed in a pair-rule pattern of 14 stripes and in specific regions of the foregut, anterior endoderm, and hindgut [PMC2500172]. Several miRNAs, including bmo-mir-31, have nucleotide differences compared to their predicted sequences or homologs in closely related species [PMC2500172].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUGUGUCACUUCGAGCCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Manduca sexta mse-miR-31
Publications