Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
5S ribosomal RNA from Escherichia coli BW25113 (PDB 8CGK, chain b) secondary structure diagram

5S ribosomal RNA from Escherichia coli BW25113 (PDB 8CGK, chain b) URS0000049E57_679895

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 57 other species

  1. Escherichia coli BL21(DE3) 5S ribosomal RNA from Escherichia coli BL21(DE3) (PDB 6QDW, chain a)
  2. Escherichia coli DH1 5S ribosomal RNA from Escherichia coli DH1 (PDB 4V6M, chain B7)
  3. Escherichia coli K-12 5S ribosomal RNA from Escherichia coli K-12 (PDB 6TBV, chain 05S1)
  4. Escherichia coli str. K-12 substr. MDS42 5S ribosomal RNA from Escherichia coli str. K-12 substr. MDS42 (PDB 4WOI, chain BB)
  5. Escherichia coli str. K-12 substr. MG1655 5S ribosomal RNA from Escherichia coli str. K-12 substr. MG1655 (PDB 7BL5, chain B)
  6. Cedecea davisae 5S rRNA
  7. Escherichia coli 55989 ribosomal RNA 5S
  8. Escherichia coli 5S rRNA
  9. Escherichia coli B7A 5S ribosomal RNA
  10. Escherichia coli B str. REL606 5S ribosomal RNA
  11. Escherichia coli BW2952 5S ribosomal RNA of rrnD operon
  12. Escherichia coli CE516 5S ribosomal RNA
  13. Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 5S ribosomal RNA
  14. Escherichia coli EC4100B 5S ribosomal RNA
  15. Escherichia coli ER2796 5S ribosomal RNA of rrnD operon
  16. Escherichia coli IAI1 ribosomal RNA 5S
  17. Escherichia coli IHE3034 5S ribosomal RNA
  18. Escherichia coli IS1 5S RNA
  19. Escherichia coli IS25 5S RNA
  20. Escherichia coli IS35 5S RNA
  21. Escherichia coli IS5 5S RNA
  22. Escherichia coli IS9 5S RNA
  23. Escherichia coli ISC41 5S RNA
  24. Escherichia coli ISC7 5S RNA
  25. Escherichia coli O103:H2 str. 12009 5S ribosomal RNA
  26. Escherichia coli O111:H- str. 11128 5S ribosomal RNA
  27. Escherichia coli O145:H28 5S ribosomal RNA
  28. Escherichia coli O145:H28 str. RM12761 5S ribosomal RNA
  29. Escherichia coli O145:H28 str. RM13516 5S ribosomal RNA
  30. Escherichia coli O25b:H4 5S ribosomal RNA
  31. Escherichia coli O26:H11 str. 11368 5S ribosomal RNA
  32. Escherichia coli O5:K4(L):H4 str. ATCC 23502 5S RNA
  33. Escherichia coli S88 ribosomal RNA 5S
  34. Escherichia coli SE11 5S ribosomal RNA
  35. Escherichia coli SE15 5S ribosomal RNA
  36. Escherichia coli str. K-12 substr. DH10B 5S ribosomal RNA
  37. Escherichia coli str. K-12 substr. MC4100 5S ribosomal RNA of rrnD operon
  38. Escherichia coli str. K-12 substr. W3110 5S rRNA
  39. Escherichia coli UMN026 ribosomal RNA 5S
  40. Escherichia coli UTI89 5S ribosomal RNA
  41. Escherichia coli VR50 5S ribosomal RNA
  42. Klebsiella pneumoniae IS22 5S RNA
  43. Salmonella enterica 5S rRNA
  44. Salmonella enterica subsp. enterica serovar Cerro 5S ribosomal RNA
  45. Salmonella enterica subsp. enterica serovar Derby ribosomal RNA
  46. Salmonella enterica subsp. enterica serovar Heidelberg str. B182 5S ribosomal RNA
  47. Salmonella enterica subsp. enterica serovar Infantis 5S RNA
  48. Salmonella enterica subsp. enterica serovar Typhimurium 5S ribosomal RNA
  49. Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 5S ribosomal RNA
  50. Salmonella enterica subsp. enterica serovar Virchow 5S ribosomal RNA
  51. Shigella boydii ATCC 9905 5S ribosomal RNA
  52. Shigella dysenteriae 1617 5S ribosomal RNA
  53. Shigella dysenteriae 5S rRNA
  54. Shigella dysenteriae CDC 74-1112 5S ribosomal RNA
  55. Shigella flexneri CDC 796-83 5S ribosomal RNA
  56. Shigella sonnei 5S ribosomal RNA
  57. synthetic Escherichia coli C321.deltaA 5S ribosomal RNA
2D structure Publications