Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bordetella pertussis 18323 ribosomal RNA secondary structure diagram

Bordetella pertussis 18323 ribosomal RNA URS000004240C_568706

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUGACGACCAUAGCAAGGUGGUCCCACUCCUUCCCAUCCCGAACAGGACAGUGAAACGCCUUCGCGCCGAUGAUAGUGGAUGUACAUCUGUGAAAGUAGGUCAUCGUCAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bordetella bronchiseptica 1289 ribosomal RNA
  2. Bordetella bronchiseptica 253 ribosomal RNA
  3. Bordetella bronchiseptica 5S rRNA
  4. Bordetella bronchiseptica Bbr77 ribosomal RNA
  5. Bordetella bronchiseptica MO149 ribosomal RNA
  6. Bordetella parapertussis 12822 ribosomal RNA
  7. Bordetella parapertussis 5S rRNA
  8. Bordetella pertussis 137 5S ribosomal RNA
  9. Bordetella pertussis 5S rRNA
  10. Bordetella pertussis B1917 5S ribosomal RNA
  11. Bordetella pertussis B1920 5S ribosomal RNA
  12. Bordetella pertussis CS 5S ribosomal RNA
2D structure