Drosophila melanogaster (fruit fly) dme-miR-971-3p URS0000041992_7227

• 22 nucleotides
• 5 databases (ENA, FlyBase, miRBase, MirGeneDB, RefSeq)
• Found in 10 other species
• 14 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UUGGUGUUACUUCUUACAGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

1. Bactrocera dorsalis bdo-miR-971
2. Cochliomyia hominivorax mature cho-miR-971
3. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-971
4. Drosophila ananassae Dan-Mir-971_3p (mature (guide))
5. Drosophila mojavensis Dmo-Mir-971_3p (mature (guide))
6. Drosophila pseudoobscura dps-miR-971-3p
7. Drosophila pseudoobscura pseudoobscura miRNA FBtr0330828_df_nrg
8. Drosophila simulans Dsi-Mir-971_3p (mature (guide))
9. Drosophila virilis dvi-miR-971-3p
10. Drosophila yakuba Dya-Mir-971_3p (mature (guide))

Publications Download

• FASTA
• JSON