Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Takifugu rubripes (torafugu) fru-miR-181a-3p URS000003F252_31033

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCAUCGACCGUUGAUUGUACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Alligator mississippiensis (American alligator) ami-miR-181a-3p
  2. Cavia porcellus cpo-miR-181a-3p
  3. Cervus elaphus cel-miR-181a-3p
  4. Chiloscyllium plagiosum microRNA cpl-miR-181a*
  5. Columba livia cli-miR-181a-3p
  6. Cricetulus griseus (Chinese hamster) cgr-miR-181a-3p
  7. Danio rerio (zebrafish) dre-miR-181a-3p
  8. Dasypus novemcinctus dno-miR-181a-3p
  9. Gallus gallus gga-miR-181a-3p
  10. Gorilla gorilla gorilla ggo-miR-181a-3p (MIR181A-1)
  11. Gorilla gorilla (western gorilla) ggo-miR-181a-3p
  12. Homo sapiens (human) hsa-miR-181a-3p
  13. Lagothrix lagotricha lla-miR-181a-3p
  14. Macaca mulatta (Rhesus monkey) mml-miR-181a-3p
  15. Macaca nemestrina (pig-tailed macaque) mne-miR-181a-3p
  16. Mus musculus (house mouse) mmu-miR-181a-1-3p
  17. Ornithorhynchus anatinus (platypus) oan-miR-181a-1-3p
  18. Oryctolagus cuniculus ocu-miR-181a-3p
  19. Pan paniscus (pygmy chimpanzee) ppa-miR-181a-3p
  20. Pan troglodytes (chimpanzee) ptr-miR-181a-3p
  21. Pongo pygmaeus (Bornean orangutan) ppy-miR-181a-3p
  22. Pteropus alecto pal-miR-181a-3p
  23. Rattus norvegicus (Norway rat) rno-miR-181a-1-3p
  24. Taeniopygia guttata (zebra finch) tgu-miR-181a-1-3p
  25. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-181a-3p
  26. Tor tambroides miR-181a-3p
Publications