Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Escherichia coli tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1) secondary structure diagram

Escherichia coli tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1) URS000003E908_562

Automated summary: This tRNA sequence is 74 nucleotides long and is found in Escherichia coli. Annotated by 4 databases (PDBe, Modomics, ENA, GtRNAdb). Described in 131 papers. Has a conserved secondary structure or a structured region. Has an experimentally determined 3D structure. Matches 1 Rfam family (tRNA, RF00005). Escherichia coli tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1) sequence is a product of tRNA-Cys-GCA-1-1, trnC, cysT, trn31 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCGCGUUAACAAAGCGGUUAUGUAGCGGAUUGCAAAUCCGUCUAGUCCGGUUCGACUCCGGAACGCGCCUCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 4,399 other species

    1. Achromobacter sp. ATCC35328 tRNA-Cys(gca)
    2. Aeromonadaceae bacterium (wastewater metagenome) tRNA-Cys
    3. Chania multitudinisentens RB-25 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4. compost metagenome tRNA-Cys
    5. Edwardsiella anguillarum ET080813 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
    6. Edwardsiella anguillarum tRNA-Cys
    7. Edwardsiella hoshinae tRNA-Cys(gca)
    8. Edwardsiella ictaluri 93-146 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    9. Edwardsiella ictaluri tRNA-Cys(gca)
    10. Edwardsiella piscicida C07-087 tRNA-Cys (GCA) (tRNA-Cys-GCA-2-1)
    11. Edwardsiella piscicida tRNA-Cys
    12. Edwardsiella sp. EA181011 tRNA-Cys
    13. Edwardsiella sp. LADL05-105 tRNA-Cys
    14. Edwardsiella tarda ATCC 15947 = NBRC 105688 tRNA-Cys
    15. Edwardsiella tarda ATCC 23685 tRNA-Cys
    16. Edwardsiella tarda EIB202 tRNA-Cys (GCA) (tRNA-Cys-GCA-2-1)
    17. Edwardsiella tarda FL6-60 tRNA-Cys (GCA) (tRNA-Cys-GCA-2-1)
    18. Edwardsiella tarda tRNA-Cys(gca)
    19. Enterobacterales bacterium 8AC tRNA-Cys
    20. Enterobacter hormaechei tRNA-Cys
    21. Enterobacteriaceae bacterium 8376wB8 tRNA-Cys
    22. Enterobacteriaceae bacterium 8376wD7 tRNA-Cys
    23. Enterobacteriaceae bacterium 8376wG6 tRNA-Cys
    24. Enterobacteriaceae bacterium 9_2_54FAA tRNA-Cys
    25. Enterobacteriaceae bacterium tRNA-Cys
    26. Enterobacteriaceae bacterium TzEc013 tRNA-Cys
    27. Enterobacteriaceae bacterium TzEc051 tRNA-Cys
    28. Enterobacteriaceae bacterium TzEc052 tRNA-Cys
    29. Enterobacteriaceae bacterium TzEc058 tRNA-Cys
    30. Enterobacteriaceae bacterium TzEc077 tRNA-Cys
    31. Enterobacteriaceae bacterium TzEc084 tRNA-Cys
    32. Enterobacter sp. EC-NT1 tRNA-Cys
    33. Erwinia sp. CPCC 100877 tRNA-Cys
    34. Escherichia albertii B156 tRNA-Cys
    35. Escherichia albertii KF1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    36. Escherichia albertii tRNA-Cys
    37. Escherichia albertii TW07627 tRNA-Cys
    38. Escherichia coli 0.1288 tRNA-Cys
    39. Escherichia coli 0.1304 tRNA-Cys
    40. Escherichia coli 042 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    41. Escherichia coli 07798 tRNA-Cys
    42. Escherichia coli 08BKT055439 tRNA-Cys
    43. Escherichia coli 08BKT77219 tRNA-Cys
    44. Escherichia coli 09BKT024447 tRNA-Cys
    45. Escherichia coli 09BKT076207 tRNA-Cys
    46. Escherichia coli 10.0821 tRNA-Cys
    47. Escherichia coli 10.0833 tRNA-Cys
    48. Escherichia coli 10.0869 tRNA-Cys
    49. Escherichia coli 101-1 tRNA-Cys
    50. Escherichia coli 110957 tRNA-Cys
    51. Escherichia coli 1-110-08_S1_C1 tRNA-Cys
    52. Escherichia coli 1-110-08_S1_C2 tRNA-Cys
    53. Escherichia coli 1-110-08_S1_C3 tRNA-Cys
    54. Escherichia coli 1-110-08_S3_C1 tRNA-Cys
    55. Escherichia coli 1-110-08_S3_C2 tRNA-Cys
    56. Escherichia coli 1-110-08_S3_C3 tRNA-Cys
    57. Escherichia coli 1-110-08_S4_C1 tRNA-Cys
    58. Escherichia coli 1-110-08_S4_C2 tRNA-Cys
    59. Escherichia coli 1-110-08_S4_C3 tRNA-Cys
    60. Escherichia coli 113290 tRNA-Cys
    61. Escherichia coli 113302 tRNA-Cys
    62. Escherichia coli 113303 tRNA-Cys
    63. Escherichia coli 1-176-05_S1_C1 tRNA-Cys
    64. Escherichia coli 1-176-05_S1_C2 tRNA-Cys
    65. Escherichia coli 1-176-05_S1_C3 tRNA-Cys
    66. Escherichia coli 1-176-05_S3_C1 tRNA-Cys
    67. Escherichia coli 1-176-05_S3_C2 tRNA-Cys
    68. Escherichia coli 1-176-05_S4_C1 tRNA-Cys
    69. Escherichia coli 1-176-05_S4_C2 tRNA-Cys
    70. Escherichia coli 1-176-05_S4_C3 tRNA-Cys
    71. Escherichia coli 1-182-04_S1_C1 tRNA-Cys
    72. Escherichia coli 1-182-04_S1_C2 tRNA-Cys
    73. Escherichia coli 1-182-04_S1_C3 tRNA-Cys
    74. Escherichia coli 1-182-04_S3_C1 tRNA-Cys
    75. Escherichia coli 1-182-04_S3_C2 tRNA-Cys
    76. Escherichia coli 1-182-04_S3_C3 tRNA-Cys
    77. Escherichia coli 1-182-04_S4_C1 tRNA-Cys
    78. Escherichia coli 1-182-04_S4_C2 tRNA-Cys
    79. Escherichia coli 1-182-04_S4_C3 tRNA-Cys
    80. Escherichia coli 1.2264 tRNA-Cys
    81. Escherichia coli 1-250-04_S1_C1 tRNA-Cys
    82. Escherichia coli 1-250-04_S1_C2 tRNA-Cys
    83. Escherichia coli 1-250-04_S1_C3 tRNA-Cys
    84. Escherichia coli 1-250-04_S3_C1 tRNA-Cys
    85. Escherichia coli 1-250-04_S3_C2 tRNA-Cys
    86. Escherichia coli 1-250-04_S4_C1 tRNA-Cys
    87. Escherichia coli 1-250-04_S4_C2 tRNA-Cys
    88. Escherichia coli 1.2741 tRNA-Cys
    89. Escherichia coli 1303 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    90. Escherichia coli 1-392-07_S1_C1 tRNA-Cys
    91. Escherichia coli 1-392-07_S1_C2 tRNA-Cys
    92. Escherichia coli 1-392-07_S3_C1 tRNA-Cys
    93. Escherichia coli 1-392-07_S3_C2 tRNA-Cys
    94. Escherichia coli 1-392-07_S3_C3 tRNA-Cys
    95. Escherichia coli 1-392-07_S4_C1 tRNA-Cys
    96. Escherichia coli 1-392-07_S4_C2 tRNA-Cys
    97. Escherichia coli 1-392-07_S4_C3 tRNA-Cys
    98. Escherichia coli 14A tRNA-Cys
    99. Escherichia coli 174750 tRNA-Cys
    100. Escherichia coli 174900 tRNA-Cys
    101. Escherichia coli 178200 tRNA-Cys
    102. Escherichia coli 178850 tRNA-Cys
    103. Escherichia coli 178900 tRNA-Cys
    104. Escherichia coli 179100 tRNA-Cys
    105. Escherichia coli 179550 tRNA-Cys
    106. Escherichia coli 180050 tRNA-Cys
    107. Escherichia coli 180200 tRNA-Cys
    108. Escherichia coli 180600 tRNA-Cys
    109. Escherichia coli 1827-70 tRNA-Cys
    110. Escherichia coli 199900.1 tRNA-Cys
    111. Escherichia coli 2-005-03_S1_C1 tRNA-Cys
    112. Escherichia coli 2-005-03_S1_C2 tRNA-Cys
    113. Escherichia coli 2-005-03_S1_C3 tRNA-Cys
    114. Escherichia coli 2-005-03_S3_C1 tRNA-Cys
    115. Escherichia coli 2-005-03_S3_C2 tRNA-Cys
    116. Escherichia coli 2-005-03_S3_C3 tRNA-Cys
    117. Escherichia coli 2-005-03_S4_C1 tRNA-Cys
    118. Escherichia coli 2-005-03_S4_C2 tRNA-Cys
    119. Escherichia coli 2-005-03_S4_C3 tRNA-Cys
    120. Escherichia coli 2-011-08_S1_C1 tRNA-Cys
    121. Escherichia coli 2-011-08_S1_C2 tRNA-Cys
    122. Escherichia coli 2-011-08_S1_C3 tRNA-Cys
    123. Escherichia coli 2-011-08_S3_C1 tRNA-Cys
    124. Escherichia coli 2-011-08_S3_C2 tRNA-Cys
    125. Escherichia coli 2-011-08_S3_C3 tRNA-Cys
    126. Escherichia coli 2-011-08_S4_C1 tRNA-Cys
    127. Escherichia coli 2-011-08_S4_C3 tRNA-Cys
    128. Escherichia coli 201600.1 tRNA-Cys
    129. Escherichia coli 2-052-05_S1_C1 tRNA-Cys
    130. Escherichia coli 2-052-05_S1_C3 tRNA-Cys
    131. Escherichia coli 2-052-05_S3_C1 tRNA-Cys
    132. Escherichia coli 2-052-05_S3_C2 tRNA-Cys
    133. Escherichia coli 2-052-05_S3_C3 tRNA-Cys
    134. Escherichia coli 2-052-05_S4_C1 tRNA-Cys
    135. Escherichia coli 2-052-05_S4_C2 tRNA-Cys
    136. Escherichia coli 2-052-05_S4_C3 tRNA-Cys
    137. Escherichia coli 2-156-04_S1_C3 tRNA-Cys
    138. Escherichia coli 2-156-04_S3_C1 tRNA-Cys
    139. Escherichia coli 2-156-04_S3_C2 tRNA-Cys
    140. Escherichia coli 2-156-04_S3_C3 tRNA-Cys
    141. Escherichia coli 2-156-04_S4_C1 tRNA-Cys
    142. Escherichia coli 2-156-04_S4_C2 tRNA-Cys
    143. Escherichia coli 2-156-04_S4_C3 tRNA-Cys
    144. Escherichia coli 2-177-06_S1_C1 tRNA-Cys
    145. Escherichia coli 2-177-06_S1_C2 tRNA-Cys
    146. Escherichia coli 2-177-06_S1_C3 tRNA-Cys
    147. Escherichia coli 2-177-06_S3_C1 tRNA-Cys
    148. Escherichia coli 2-177-06_S3_C2 tRNA-Cys
    149. Escherichia coli 2-177-06_S3_C3 tRNA-Cys
    150. Escherichia coli 2-177-06_S4_C1 tRNA-Cys
    151. Escherichia coli 2-177-06_S4_C2 tRNA-Cys
    152. Escherichia coli 2-177-06_S4_C3 tRNA-Cys
    153. Escherichia coli 2-210-07_S1_C2 tRNA-Cys
    154. Escherichia coli 2-210-07_S1_C3 tRNA-Cys
    155. Escherichia coli 2-210-07_S3_C1 tRNA-Cys
    156. Escherichia coli 2-210-07_S3_C2 tRNA-Cys
    157. Escherichia coli 2-210-07_S3_C3 tRNA-Cys
    158. Escherichia coli 2-210-07_S4_C1 tRNA-Cys
    159. Escherichia coli 2-210-07_S4_C2 tRNA-Cys
    160. Escherichia coli 2-210-07_S4_C3 tRNA-Cys
    161. Escherichia coli 2-222-05_S1_C1 tRNA-Cys
    162. Escherichia coli 2-222-05_S1_C2 tRNA-Cys
    163. Escherichia coli 2-222-05_S1_C3 tRNA-Cys
    164. Escherichia coli 2-222-05_S3_C1 tRNA-Cys
    165. Escherichia coli 2-222-05_S3_C2 tRNA-Cys
    166. Escherichia coli 2-222-05_S3_C3 tRNA-Cys
    167. Escherichia coli 2-222-05_S4_C1 tRNA-Cys
    168. Escherichia coli 2-222-05_S4_C2 tRNA-Cys
    169. Escherichia coli 2-222-05_S4_C3 tRNA-Cys
    170. Escherichia coli 2-316-03_S1_C1 tRNA-Cys
    171. Escherichia coli 2-316-03_S1_C2 tRNA-Cys
    172. Escherichia coli 2-316-03_S3_C1 tRNA-Cys
    173. Escherichia coli 2-316-03_S3_C2 tRNA-Cys
    174. Escherichia coli 2-316-03_S3_C3 tRNA-Cys
    175. Escherichia coli 2-316-03_S4_C1 tRNA-Cys
    176. Escherichia coli 2-316-03_S4_C2 tRNA-Cys
    177. Escherichia coli 2-316-03_S4_C3 tRNA-Cys
    178. Escherichia coli 2362-75 tRNA-Cys
    179. Escherichia coli 2.3916 tRNA-Cys
    180. Escherichia coli 2.4168 tRNA-Cys
    181. Escherichia coli 2-427-07_S1_C1 tRNA-Cys
    182. Escherichia coli 2-427-07_S1_C2 tRNA-Cys
    183. Escherichia coli 2-427-07_S1_C3 tRNA-Cys
    184. Escherichia coli 2-427-07_S3_C1 tRNA-Cys
    185. Escherichia coli 2-427-07_S3_C3 tRNA-Cys
    186. Escherichia coli 2-427-07_S4_C1 tRNA-Cys
    187. Escherichia coli 2-427-07_S4_C2 tRNA-Cys
    188. Escherichia coli 2-427-07_S4_C3 tRNA-Cys
    189. Escherichia coli 2-460-02_S1_C1 tRNA-Cys
    190. Escherichia coli 2-460-02_S1_C2 tRNA-Cys
    191. Escherichia coli 2-460-02_S1_C3 tRNA-Cys
    192. Escherichia coli 2-460-02_S3_C1 tRNA-Cys
    193. Escherichia coli 2-460-02_S3_C2 tRNA-Cys
    194. Escherichia coli 2-460-02_S3_C3 tRNA-Cys
    195. Escherichia coli 2-460-02_S4_C1 tRNA-Cys
    196. Escherichia coli 2-460-02_S4_C2 tRNA-Cys
    197. Escherichia coli 2-460-02_S4_C3 tRNA-Cys
    198. Escherichia coli 2-474-04_S1_C1 tRNA-Cys
    199. Escherichia coli 2-474-04_S1_C2 tRNA-Cys
    200. Escherichia coli 2-474-04_S3_C1 tRNA-Cys
    201. Escherichia coli 2-474-04_S3_C2 tRNA-Cys
    202. Escherichia coli 2-474-04_S3_C3 tRNA-Cys
    203. Escherichia coli 2-474-04_S4_C1 tRNA-Cys
    204. Escherichia coli 2-474-04_S4_C2 tRNA-Cys
    205. Escherichia coli 2-474-04_S4_C3 tRNA-Cys
    206. Escherichia coli 2534-86 tRNA-Cys
    207. Escherichia coli 2719100 tRNA-Cys
    208. Escherichia coli 2720900 tRNA-Cys
    209. Escherichia coli 2722950 tRNA-Cys
    210. Escherichia coli 2726800 tRNA-Cys
    211. Escherichia coli 2726950 tRNA-Cys
    212. Escherichia coli 2729250 tRNA-Cys
    213. Escherichia coli 2730350 tRNA-Cys
    214. Escherichia coli 2730450 tRNA-Cys
    215. Escherichia coli 2731150 tRNA-Cys
    216. Escherichia coli 2733950 tRNA-Cys
    217. Escherichia coli 2735000 tRNA-Cys
    218. Escherichia coli 2741950 tRNA-Cys
    219. Escherichia coli 2747800 tRNA-Cys
    220. Escherichia coli 2749250 tRNA-Cys
    221. Escherichia coli 2756500 tRNA-Cys
    222. Escherichia coli 2762100 tRNA-Cys
    223. Escherichia coli 2770900 tRNA-Cys
    224. Escherichia coli 2780750 tRNA-Cys
    225. Escherichia coli 2785200 tRNA-Cys
    226. Escherichia coli 2788150 tRNA-Cys
    227. Escherichia coli 2845350 tRNA-Cys
    228. Escherichia coli 2845650 tRNA-Cys
    229. Escherichia coli 2846750 tRNA-Cys
    230. Escherichia coli 2848050 tRNA-Cys
    231. Escherichia coli 2850400 tRNA-Cys
    232. Escherichia coli 2850750 tRNA-Cys
    233. Escherichia coli 2851500 tRNA-Cys
    234. Escherichia coli 2853500 tRNA-Cys
    235. Escherichia coli 2854350 tRNA-Cys
    236. Escherichia coli 2860050 tRNA-Cys
    237. Escherichia coli 2860650 tRNA-Cys
    238. Escherichia coli 2861200 tRNA-Cys
    239. Escherichia coli 2862600 tRNA-Cys
    240. Escherichia coli 2864350 tRNA-Cys
    241. Escherichia coli 2865200 tRNA-Cys
    242. Escherichia coli 2866350 tRNA-Cys
    243. Escherichia coli 2866450 tRNA-Cys
    244. Escherichia coli 2866550 tRNA-Cys
    245. Escherichia coli 2866750 tRNA-Cys
    246. Escherichia coli 2867750 tRNA-Cys
    247. Escherichia coli 2871950 tRNA-Cys
    248. Escherichia coli 2872000 tRNA-Cys
    249. Escherichia coli 2872800 tRNA-Cys
    250. Escherichia coli 2875000 tRNA-Cys
    251. Escherichia coli 2875150 tRNA-Cys
    252. Escherichia coli 2886-75 tRNA-Cys
    253. Escherichia coli 3003 tRNA-Cys
    254. Escherichia coli 3006 tRNA-Cys
    255. Escherichia coli 3-020-07_S1_C1 tRNA-Cys
    256. Escherichia coli 3-020-07_S1_C2 tRNA-Cys
    257. Escherichia coli 3-020-07_S1_C3 tRNA-Cys
    258. Escherichia coli 3-020-07_S3_C1 tRNA-Cys
    259. Escherichia coli 3-020-07_S3_C2 tRNA-Cys
    260. Escherichia coli 3-020-07_S4_C1 tRNA-Cys
    261. Escherichia coli 3-020-07_S4_C2 tRNA-Cys
    262. Escherichia coli 3-020-07_S4_C3 tRNA-Cys
    263. Escherichia coli 3030-1 tRNA-Cys
    264. Escherichia coli 3-073-06_S1_C1 tRNA-Cys
    265. Escherichia coli 3-073-06_S1_C2 tRNA-Cys
    266. Escherichia coli 3-073-06_S3_C1 tRNA-Cys
    267. Escherichia coli 3-073-06_S3_C2 tRNA-Cys
    268. Escherichia coli 3-073-06_S4_C1 tRNA-Cys
    269. Escherichia coli 3-073-06_S4_C2 tRNA-Cys
    270. Escherichia coli 3-073-06_S4_C3 tRNA-Cys
    271. Escherichia coli 3-105-05_S1_C1 tRNA-Cys
    272. Escherichia coli 3-105-05_S1_C2 tRNA-Cys
    273. Escherichia coli 3-105-05_S1_C3 tRNA-Cys
    274. Escherichia coli 3-105-05_S3_C1 tRNA-Cys
    275. Escherichia coli 3-105-05_S3_C2 tRNA-Cys
    276. Escherichia coli 3-105-05_S3_C3 tRNA-Cys
    277. Escherichia coli 3-105-05_S4_C1 tRNA-Cys
    278. Escherichia coli 3-105-05_S4_C2 tRNA-Cys
    279. Escherichia coli 3-105-05_S4_C3 tRNA-Cys
    280. Escherichia coli 3.2303 tRNA-Cys
    281. Escherichia coli 3.2608 tRNA-Cys
    282. Escherichia coli 3-267-03_S1_C1 tRNA-Cys
    283. Escherichia coli 3-267-03_S1_C2 tRNA-Cys
    284. Escherichia coli 3-267-03_S1_C3 tRNA-Cys
    285. Escherichia coli 3-267-03_S3_C1 tRNA-Cys
    286. Escherichia coli 3-267-03_S3_C2 tRNA-Cys
    287. Escherichia coli 3-267-03_S4_C1 tRNA-Cys
    288. Escherichia coli 3-267-03_S4_C2 tRNA-Cys
    289. Escherichia coli 3-373-03_S1_C1 tRNA-Cys
    290. Escherichia coli 3-373-03_S1_C2 tRNA-Cys
    291. Escherichia coli 3-373-03_S1_C3 tRNA-Cys
    292. Escherichia coli 3-373-03_S3_C1 tRNA-Cys
    293. Escherichia coli 3-373-03_S3_C2 tRNA-Cys
    294. Escherichia coli 3-373-03_S3_C3 tRNA-Cys
    295. Escherichia coli 3-373-03_S4_C1 tRNA-Cys
    296. Escherichia coli 3-373-03_S4_C2 tRNA-Cys
    297. Escherichia coli 3-373-03_S4_C3 tRNA-Cys
    298. Escherichia coli 3.3884 tRNA-Cys
    299. Escherichia coli 3431 tRNA-Cys
    300. Escherichia coli 3-475-03_S1_C1 tRNA-Cys
    301. Escherichia coli 3-475-03_S1_C2 tRNA-Cys
    302. Escherichia coli 3-475-03_S3_C1 tRNA-Cys
    303. Escherichia coli 3-475-03_S3_C2 tRNA-Cys
    304. Escherichia coli 3-475-03_S4_C1 tRNA-Cys
    305. Escherichia coli 3-475-03_S4_C2 tRNA-Cys
    306. Escherichia coli 3.4870 tRNA-Cys
    307. Escherichia coli 3.4880 tRNA-Cys
    308. Escherichia coli 4.0522 tRNA-Cys
    309. Escherichia coli 4.0967 tRNA-Cys
    310. Escherichia coli 4_1_47FAA tRNA-Cys
    311. Escherichia coli 4-203-08_S1_C1 tRNA-Cys
    312. Escherichia coli 4-203-08_S1_C2 tRNA-Cys
    313. Escherichia coli 4-203-08_S1_C3 tRNA-Cys
    314. Escherichia coli 4-203-08_S3_C1 tRNA-Cys
    315. Escherichia coli 4-203-08_S3_C2 tRNA-Cys
    316. Escherichia coli 4-203-08_S3_C3 tRNA-Cys
    317. Escherichia coli 4-203-08_S4_C2 tRNA-Cys
    318. Escherichia coli 4-203-08_S4_C3 tRNA-Cys
    319. Escherichia coli 5.0588 tRNA-Cys
    320. Escherichia coli 5.0959 tRNA-Cys
    321. Escherichia coli 5-172-05_S1_C3 tRNA-Cys
    322. Escherichia coli 5-172-05_S3_C1 tRNA-Cys
    323. Escherichia coli 5-172-05_S3_C3 tRNA-Cys
    324. Escherichia coli 5-172-05_S4_C1 tRNA-Cys
    325. Escherichia coli 5-172-05_S4_C2 tRNA-Cys
    326. Escherichia coli 5-172-05_S4_C3 tRNA-Cys
    327. Escherichia coli 5.2239 tRNA-Cys
    328. Escherichia coli 53638 tRNA-Cys
    329. Escherichia coli 5-366-08_S1_C1 tRNA-Cys
    330. Escherichia coli 5-366-08_S1_C3 tRNA-Cys
    331. Escherichia coli 5-366-08_S3_C1 tRNA-Cys
    332. Escherichia coli 5-366-08_S3_C2 tRNA-Cys
    333. Escherichia coli 5-366-08_S3_C3 tRNA-Cys
    334. Escherichia coli 5-366-08_S4_C1 tRNA-Cys
    335. Escherichia coli 5-366-08_S4_C2 tRNA-Cys
    336. Escherichia coli 536 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    337. Escherichia coli 541-15 tRNA-Cys
    338. Escherichia coli 541-1 tRNA-Cys
    339. Escherichia coli 5412 tRNA-Cys
    340. Escherichia coli 55989 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    341. Escherichia coli 576-1 tRNA-Cys
    342. Escherichia coli 5905 tRNA-Cys
    343. Escherichia coli 6.0172 tRNA-Cys
    344. Escherichia coli 6-175-07_S1_C1 tRNA-Cys
    345. Escherichia coli 6-175-07_S1_C2 tRNA-Cys
    346. Escherichia coli 6-175-07_S1_C3 tRNA-Cys
    347. Escherichia coli 6-175-07_S3_C1 tRNA-Cys
    348. Escherichia coli 6-175-07_S3_C2 tRNA-Cys
    349. Escherichia coli 6-175-07_S3_C3 tRNA-Cys
    350. Escherichia coli 6-175-07_S4_C1 tRNA-Cys
    351. Escherichia coli 6-175-07_S4_C2 tRNA-Cys
    352. Escherichia coli 6-175-07_S4_C3 tRNA-Cys
    353. Escherichia coli 6-319-05_S1_C1 tRNA-Cys
    354. Escherichia coli 6-319-05_S1_C2 tRNA-Cys
    355. Escherichia coli 6-319-05_S1_C3 tRNA-Cys
    356. Escherichia coli 6-319-05_S3_C1 tRNA-Cys
    357. Escherichia coli 6-319-05_S3_C2 tRNA-Cys
    358. Escherichia coli 6-319-05_S3_C3 tRNA-Cys
    359. Escherichia coli 6-319-05_S4_C2 tRNA-Cys
    360. Escherichia coli 6-319-05_S4_C3 tRNA-Cys
    361. Escherichia coli 6-537-08_S1_C1 tRNA-Cys
    362. Escherichia coli 6-537-08_S1_C2 tRNA-Cys
    363. Escherichia coli 6-537-08_S1_C3 tRNA-Cys
    364. Escherichia coli 6-537-08_S3_C1 tRNA-Cys
    365. Escherichia coli 6-537-08_S3_C2 tRNA-Cys
    366. Escherichia coli 6-537-08_S3_C3 tRNA-Cys
    367. Escherichia coli 6-537-08_S4_C1 tRNA-Cys
    368. Escherichia coli 6-537-08_S4_C2 tRNA-Cys
    369. Escherichia coli 7.1982 tRNA-Cys
    370. Escherichia coli 7-233-03_S1_C2 tRNA-Cys
    371. Escherichia coli 7-233-03_S1_C3 tRNA-Cys
    372. Escherichia coli 7-233-03_S3_C1 tRNA-Cys
    373. Escherichia coli 7-233-03_S3_C2 tRNA-Cys
    374. Escherichia coli 7-233-03_S3_C3 tRNA-Cys
    375. Escherichia coli 7-233-03_S4_C1 tRNA-Cys
    376. Escherichia coli 7-233-03_S4_C2 tRNA-Cys
    377. Escherichia coli 7-233-03_S4_C3 tRNA-Cys
    378. Escherichia coli 75 tRNA-Cys
    379. Escherichia coli 8.0416 tRNA-Cys
    380. Escherichia coli 8.0566 tRNA-Cys
    381. Escherichia coli 8.0569 tRNA-Cys
    382. Escherichia coli 8.0586 tRNA-Cys
    383. Escherichia coli 8.2524 tRNA-Cys
    384. Escherichia coli 83972 tRNA-Cys
    385. Escherichia coli 8-415-05_S1_C1 tRNA-Cys
    386. Escherichia coli 8-415-05_S1_C2 tRNA-Cys
    387. Escherichia coli 8-415-05_S3_C1 tRNA-Cys
    388. Escherichia coli 8-415-05_S3_C2 tRNA-Cys
    389. Escherichia coli 8-415-05_S3_C3 tRNA-Cys
    390. Escherichia coli 8-415-05_S4_C1 tRNA-Cys
    391. Escherichia coli 8-415-05_S4_C2 tRNA-Cys
    392. Escherichia coli 8-415-05_S4_C3 tRNA-Cys
    393. Escherichia coli 88.0221 tRNA-Cys
    394. Escherichia coli 88.1042 tRNA-Cys
    395. Escherichia coli 88.1467 tRNA-Cys
    396. Escherichia coli 89.0511 tRNA-Cys
    397. Escherichia coli 90.0039 tRNA-Cys
    398. Escherichia coli 90.0091 tRNA-Cys
    399. Escherichia coli 900105 (10e) tRNA-Cys
    400. Escherichia coli 9.0111 tRNA-Cys
    401. Escherichia coli 90.2281 tRNA-Cys
    402. Escherichia coli 907357 tRNA-Cys
    403. Escherichia coli 907391 tRNA-Cys
    404. Escherichia coli 907446 tRNA-Cys
    405. Escherichia coli 907672 tRNA-Cys
    406. Escherichia coli 907700 tRNA-Cys
    407. Escherichia coli 907701 tRNA-Cys
    408. Escherichia coli 907710 tRNA-Cys
    409. Escherichia coli 907713 tRNA-Cys
    410. Escherichia coli 907715 tRNA-Cys
    411. Escherichia coli 907779 tRNA-Cys
    412. Escherichia coli 907889 tRNA-Cys
    413. Escherichia coli 907892 tRNA-Cys
    414. Escherichia coli 908519 tRNA-Cys
    415. Escherichia coli 908521 tRNA-Cys
    416. Escherichia coli 908522 tRNA-Cys
    417. Escherichia coli 908524 tRNA-Cys
    418. Escherichia coli 908525 tRNA-Cys
    419. Escherichia coli 908541 tRNA-Cys
    420. Escherichia coli 908555 tRNA-Cys
    421. Escherichia coli 908573 tRNA-Cys
    422. Escherichia coli 908585 tRNA-Cys
    423. Escherichia coli 908616 tRNA-Cys
    424. Escherichia coli 908624 tRNA-Cys
    425. Escherichia coli 908632 tRNA-Cys
    426. Escherichia coli 908658 tRNA-Cys
    427. Escherichia coli 908675 tRNA-Cys
    428. Escherichia coli 908691 tRNA-Cys
    429. Escherichia coli 909945-2 tRNA-Cys
    430. Escherichia coli 910096-2 tRNA-Cys
    431. Escherichia coli 9.1649 tRNA-Cys
    432. Escherichia coli 93-001 tRNA-Cys
    433. Escherichia coli 93.0055 tRNA-Cys
    434. Escherichia coli 93.0056 tRNA-Cys
    435. Escherichia coli 93.0624 tRNA-Cys
    436. Escherichia coli 94.0618 tRNA-Cys
    437. Escherichia coli 95.0083 tRNA-Cys
    438. Escherichia coli 95.0183 tRNA-Cys
    439. Escherichia coli 95.0943 tRNA-Cys
    440. Escherichia coli 95.1288 tRNA-Cys
    441. Escherichia coli 95JB1 tRNA-Cys
    442. Escherichia coli 95NR1 tRNA-Cys
    443. Escherichia coli 96.0107 tRNA-Cys
    444. Escherichia coli 96.0109 tRNA-Cys
    445. Escherichia coli 96.0427 tRNA-Cys
    446. Escherichia coli 96.0428 tRNA-Cys
    447. Escherichia coli 96.0497 tRNA-Cys
    448. Escherichia coli 96.0932 tRNA-Cys
    449. Escherichia coli 96.0939 tRNA-Cys
    450. Escherichia coli 96.154 tRNA-Cys
    451. Escherichia coli 97.0003 tRNA-Cys
    452. Escherichia coli 97.0007 tRNA-Cys
    453. Escherichia coli 97.0010 tRNA-Cys
    454. Escherichia coli 97.0246 tRNA-Cys
    455. Escherichia coli 97.0259 tRNA-Cys
    456. Escherichia coli 97.0264 tRNA-Cys
    457. Escherichia coli 97.1742 tRNA-Cys
    458. Escherichia coli 99.0670 tRNA-Cys
    459. Escherichia coli 99.0672 tRNA-Cys
    460. Escherichia coli 99.0678 tRNA-Cys
    461. Escherichia coli 99.0713 tRNA-Cys
    462. Escherichia coli 99.0741 tRNA-Cys
    463. Escherichia coli 99.0814 tRNA-Cys
    464. Escherichia coli 99.0815 tRNA-Cys
    465. Escherichia coli 99.0816 tRNA-Cys
    466. Escherichia coli 99.0839 tRNA-Cys
    467. Escherichia coli 99.0848 tRNA-Cys
    468. Escherichia coli 99.1753 tRNA-Cys
    469. Escherichia coli 99.1762 tRNA-Cys
    470. Escherichia coli 99.1775 tRNA-Cys
    471. Escherichia coli 99.1781 tRNA-Cys
    472. Escherichia coli 99.1793 tRNA-Cys
    473. Escherichia coli 99.1805 tRNA-Cys
    474. Escherichia coli A25922R tRNA-Cys
    475. Escherichia coli A35218R tRNA-Cys
    476. Escherichia coli AA86 tRNA-Cys
    477. Escherichia coli ABU 83972 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    478. Escherichia coli ACN001 tRNA-Cys
    479. Escherichia coli AD30 tRNA-Cys
    480. Escherichia coli AI27 tRNA-Cys
    481. Escherichia coli APEC IMT5155 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    482. Escherichia coli APEC O18 tRNA-Cys
    483. Escherichia coli APEC O1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    484. Escherichia coli APEC O2-211 tRNA-Cys
    485. Escherichia coli APEC O2 tRNA-Cys
    486. Escherichia coli APEC O78 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    487. Escherichia coli ARS4.2123 tRNA-Cys
    488. Escherichia coli ATCC 25922 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    489. Escherichia coli ATCC 35150 tRNA-Cys
    490. Escherichia coli ATCC 700728 tRNA-Cys
    491. Escherichia coli ATCC 8739 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    492. Escherichia coli ATCC BAA-2192 tRNA-Cys
    493. Escherichia coli ATCC BAA-2193 tRNA-Cys
    494. Escherichia coli ATCC BAA-2196 tRNA-Cys
    495. Escherichia coli ATCC BAA-2209 tRNA-Cys
    496. Escherichia coli ATCC BAA-2215 tRNA-Cys
    497. Escherichia coli ATCC BAA-2219 tRNA-Cys
    498. Escherichia coli B088 tRNA-Cys
    499. Escherichia coli B093 tRNA-Cys
    500. Escherichia coli B102 tRNA-Cys
    501. Escherichia coli B103 tRNA-Cys
    502. Escherichia coli B104 tRNA-Cys
    503. Escherichia coli B105 tRNA-Cys
    504. Escherichia coli B106 tRNA-Cys
    505. Escherichia coli B107 tRNA-Cys
    506. Escherichia coli B108 tRNA-Cys
    507. Escherichia coli B109 tRNA-Cys
    508. Escherichia coli B112 tRNA-Cys
    509. Escherichia coli B113 tRNA-Cys
    510. Escherichia coli B114 tRNA-Cys
    511. Escherichia coli B15 tRNA-Cys
    512. Escherichia coli B171 tRNA-Cys
    513. Escherichia coli B175 tRNA-Cys
    514. Escherichia coli B17 tRNA-Cys
    515. Escherichia coli B185 tRNA-Cys
    516. Escherichia coli B26-1 tRNA-Cys
    517. Escherichia coli B26-2 tRNA-Cys
    518. Escherichia coli B28-1 tRNA-Cys
    519. Escherichia coli B28-2 tRNA-Cys
    520. Escherichia coli B29-1 tRNA-Cys
    521. Escherichia coli B29-2 tRNA-Cys
    522. Escherichia coli B354 tRNA-Cys
    523. Escherichia coli B36-1 tRNA-Cys
    524. Escherichia coli B36-2 tRNA-Cys
    525. Escherichia coli B367 tRNA-Cys
    526. Escherichia coli B40-1 tRNA-Cys
    527. Escherichia coli B40-2 tRNA-Cys
    528. Escherichia coli B41 tRNA-Cys
    529. Escherichia coli B49-2 tRNA-Cys
    530. Escherichia coli B5-2 tRNA-Cys
    531. Escherichia coli B574 tRNA-Cys
    532. Escherichia coli B671 tRNA-Cys
    533. Escherichia coli B7-1 tRNA-Cys
    534. Escherichia coli B7-2 tRNA-Cys
    535. Escherichia coli B799 tRNA-Cys
    536. Escherichia coli B7A tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    537. Escherichia coli B83 tRNA-Cys
    538. Escherichia coli B84 tRNA-Cys
    539. Escherichia coli B85 tRNA-Cys
    540. Escherichia coli B86 tRNA-Cys
    541. Escherichia coli B89 tRNA-Cys
    542. Escherichia coli B90 tRNA-Cys
    543. Escherichia coli B921 tRNA-Cys
    544. Escherichia coli B93 tRNA-Cys
    545. Escherichia coli B94 tRNA-Cys
    546. Escherichia coli B95 tRNA-Cys
    547. Escherichia coli BCE001_MS16 tRNA-Cys
    548. Escherichia coli BCE002_MS12 tRNA-Cys
    549. Escherichia coli BCE006_MS-23 tRNA-Cys
    550. Escherichia coli BCE007_MS-11 tRNA-Cys
    551. Escherichia coli BCE008_MS-01 tRNA-Cys
    552. Escherichia coli BCE008_MS-13 tRNA-Cys
    553. Escherichia coli BCE011_MS-01 tRNA-Cys
    554. Escherichia coli BCE019_MS-13 tRNA-Cys
    555. Escherichia coli BCE030_MS-09 tRNA-Cys
    556. Escherichia coli BCE032_MS-12 tRNA-Cys
    557. Escherichia coli BCE034_MS-14 tRNA-Cys
    558. Escherichia coli Bd5610_99 tRNA-Cys
    559. Escherichia coli BIDMC 15 tRNA-Cys
    560. Escherichia coli BIDMC 17A tRNA-Cys
    561. Escherichia coli BIDMC 17B tRNA-Cys
    562. Escherichia coli BIDMC 19A tRNA-Cys
    563. Escherichia coli BIDMC 19B tRNA-Cys
    564. Escherichia coli BIDMC 19C tRNA-Cys
    565. Escherichia coli BIDMC 20A tRNA-Cys
    566. Escherichia coli BIDMC 20B tRNA-Cys
    567. Escherichia coli BIDMC 2B tRNA-Cys
    568. Escherichia coli BIDMC 37 tRNA-Cys
    569. Escherichia coli BIDMC 38 tRNA-Cys
    570. Escherichia coli BIDMC 39 tRNA-Cys
    571. Escherichia coli BIDMC 3 tRNA-Cys
    572. Escherichia coli BIDMC 43a tRNA-Cys
    573. Escherichia coli BIDMC 43b tRNA-Cys
    574. Escherichia coli BIDMC 49a tRNA-Cys
    575. Escherichia coli BIDMC 49b tRNA-Cys
    576. Escherichia coli BIDMC 58 tRNA-Cys
    577. Escherichia coli BIDMC 59 tRNA-Cys
    578. Escherichia coli BIDMC 62 tRNA-Cys
    579. Escherichia coli BIDMC 63 tRNA-Cys
    580. Escherichia coli BIDMC 64 tRNA-Cys
    581. Escherichia coli BIDMC 65 tRNA-Cys
    582. Escherichia coli BIDMC 6 tRNA-Cys
    583. Escherichia coli BIDMC 70 tRNA-Cys
    584. Escherichia coli BIDMC 71 tRNA-Cys
    585. Escherichia coli BIDMC 72 tRNA-Cys
    586. Escherichia coli BIDMC 73 tRNA-Cys
    587. Escherichia coli BIDMC 74 tRNA-Cys
    588. Escherichia coli BIDMC 75 tRNA-Cys
    589. Escherichia coli BIDMC 76 tRNA-Cys
    590. Escherichia coli BIDMC 77 tRNA-Cys
    591. Escherichia coli BIDMC 78 tRNA-Cys
    592. Escherichia coli BIDMC 79 tRNA-Cys
    593. Escherichia coli BIDMC 82 tRNA-Cys
    594. Escherichia coli BIDMC 83 tRNA-Cys
    595. Escherichia coli BIDMC 9 tRNA-Cys
    596. Escherichia coli BL21(DE3) tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    597. Escherichia coli 'BL21-Gold(DE3)pLysS AG' tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    598. Escherichia coli BL21 tRNA-Cys
    599. Escherichia coli B str. REL606 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    600. Escherichia coli B tRNA-Cys
    601. Escherichia coli BW25113 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    602. Escherichia coli BW2952 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    603. Escherichia coli BWH 24 tRNA-Cys
    604. Escherichia coli BWH 32 tRNA-Cys
    605. Escherichia coli BWH 34 tRNA-Cys
    606. Escherichia coli BWH 40 tRNA-Cys
    607. Escherichia coli C-34666 tRNA-Cys
    608. Escherichia coli C691-71 (14b) tRNA-Cys
    609. Escherichia coli CAG:4 transfer RNA-Cys(GCA)
    610. Escherichia coli CB7326 tRNA-Cys
    611. Escherichia coli CFT073 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    612. Escherichia coli CHS 68 tRNA-Cys
    613. Escherichia coli CHS 69 tRNA-Cys
    614. Escherichia coli CHS 77 tRNA-Cys
    615. Escherichia coli C tRNA-Cys
    616. Escherichia coli CUMT8 tRNA-Cys
    617. Escherichia coli D6-113.11 transfer RNA-Cys
    618. Escherichia coli D9 tRNA-Cys
    619. Escherichia coli DEC10A tRNA-Cys
    620. Escherichia coli DEC10B tRNA-Cys
    621. Escherichia coli DEC10C tRNA-Cys
    622. Escherichia coli DEC10D tRNA-Cys
    623. Escherichia coli DEC10E tRNA-Cys
    624. Escherichia coli DEC10F tRNA-Cys
    625. Escherichia coli DEC11A tRNA-Cys
    626. Escherichia coli DEC11B tRNA-Cys
    627. Escherichia coli DEC11C tRNA-Cys
    628. Escherichia coli DEC11D tRNA-Cys
    629. Escherichia coli DEC11E tRNA-Cys
    630. Escherichia coli DEC12A tRNA-Cys
    631. Escherichia coli DEC12B tRNA-Cys
    632. Escherichia coli DEC12C tRNA-Cys
    633. Escherichia coli DEC12D tRNA-Cys
    634. Escherichia coli DEC12E tRNA-Cys
    635. Escherichia coli DEC13A tRNA-Cys
    636. Escherichia coli DEC13B tRNA-Cys
    637. Escherichia coli DEC13C tRNA-Cys
    638. Escherichia coli DEC13D tRNA-Cys
    639. Escherichia coli DEC13E tRNA-Cys
    640. Escherichia coli DEC14A tRNA-Cys
    641. Escherichia coli DEC14B tRNA-Cys
    642. Escherichia coli DEC14C tRNA-Cys
    643. Escherichia coli DEC14D tRNA-Cys
    644. Escherichia coli DEC15A tRNA-Cys
    645. Escherichia coli DEC15B tRNA-Cys
    646. Escherichia coli DEC15C tRNA-Cys
    647. Escherichia coli DEC15D tRNA-Cys
    648. Escherichia coli DEC15E tRNA-Cys
    649. Escherichia coli DEC1A tRNA-Cys
    650. Escherichia coli DEC1B tRNA-Cys
    651. Escherichia coli DEC1C tRNA-Cys
    652. Escherichia coli DEC1D tRNA-Cys
    653. Escherichia coli DEC1E tRNA-Cys
    654. Escherichia coli DEC2A tRNA-Cys
    655. Escherichia coli DEC2B tRNA-Cys
    656. Escherichia coli DEC2C tRNA-Cys
    657. Escherichia coli DEC2D tRNA-Cys
    658. Escherichia coli DEC2E tRNA-Cys
    659. Escherichia coli DEC3A tRNA-Cys
    660. Escherichia coli DEC3B tRNA-Cys
    661. Escherichia coli DEC3C tRNA-Cys
    662. Escherichia coli DEC3D tRNA-Cys
    663. Escherichia coli DEC3E tRNA-Cys
    664. Escherichia coli DEC3F tRNA-Cys
    665. Escherichia coli DEC4A tRNA-Cys
    666. Escherichia coli DEC4B tRNA-Cys
    667. Escherichia coli DEC4C tRNA-Cys
    668. Escherichia coli DEC4D tRNA-Cys
    669. Escherichia coli DEC4E tRNA-Cys
    670. Escherichia coli DEC4F tRNA-Cys
    671. Escherichia coli DEC5A tRNA-Cys
    672. Escherichia coli DEC5B tRNA-Cys
    673. Escherichia coli DEC5C tRNA-Cys
    674. Escherichia coli DEC5D tRNA-Cys
    675. Escherichia coli DEC5E tRNA-Cys
    676. Escherichia coli DEC6A tRNA-Cys
    677. Escherichia coli DEC6B tRNA-Cys
    678. Escherichia coli DEC6C tRNA-Cys
    679. Escherichia coli DEC6D tRNA-Cys
    680. Escherichia coli DEC6E tRNA-Cys
    681. Escherichia coli DEC7A tRNA-Cys
    682. Escherichia coli DEC7B tRNA-Cys
    683. Escherichia coli DEC7C tRNA-Cys
    684. Escherichia coli DEC7D tRNA-Cys
    685. Escherichia coli DEC7E tRNA-Cys
    686. Escherichia coli DEC8A tRNA-Cys
    687. Escherichia coli DEC8B tRNA-Cys
    688. Escherichia coli DEC8C tRNA-Cys
    689. Escherichia coli DEC8D tRNA-Cys
    690. Escherichia coli DEC8E tRNA-Cys
    691. Escherichia coli DEC9A tRNA-Cys
    692. Escherichia coli DEC9B tRNA-Cys
    693. Escherichia coli DEC9C tRNA-Cys
    694. Escherichia coli DEC9D tRNA-Cys
    695. Escherichia coli DEC9E tRNA-Cys
    696. Escherichia coli DH1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    697. Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 tRNA-Cys
    698. Escherichia coli E1002 tRNA-Cys
    699. Escherichia coli E101 tRNA-Cys
    700. Escherichia coli E1114 tRNA-Cys
    701. Escherichia coli E1118 tRNA-Cys
    702. Escherichia coli E1140 tRNA-Cys
    703. Escherichia coli E1167 tRNA-Cys
    704. Escherichia coli E128010 tRNA-Cys
    705. Escherichia coli E1520 tRNA-Cys
    706. Escherichia coli E1728 tRNA-Cys
    707. Escherichia coli E22 tRNA-Cys
    708. Escherichia coli E267 tRNA-Cys
    709. Escherichia coli E482 tRNA-Cys
    710. Escherichia coli E560 tRNA-Cys
    711. Escherichia coli E704 tRNA-Cys
    712. Escherichia coli EC096/10 tRNA-Cys
    713. Escherichia coli EC1734 tRNA-Cys
    714. Escherichia coli EC1735 tRNA-Cys
    715. Escherichia coli EC1736 tRNA-Cys
    716. Escherichia coli EC1737 tRNA-Cys
    717. Escherichia coli EC1738 tRNA-Cys
    718. Escherichia coli EC1845 tRNA-Cys
    719. Escherichia coli EC1846 tRNA-Cys
    720. Escherichia coli EC1847 tRNA-Cys
    721. Escherichia coli EC1848 tRNA-Cys
    722. Escherichia coli EC1849 tRNA-Cys
    723. Escherichia coli EC1850 tRNA-Cys
    724. Escherichia coli EC1856 tRNA-Cys
    725. Escherichia coli EC1862 tRNA-Cys
    726. Escherichia coli EC1863 tRNA-Cys
    727. Escherichia coli EC1864 tRNA-Cys
    728. Escherichia coli EC1865 tRNA-Cys
    729. Escherichia coli EC1866 tRNA-Cys
    730. Escherichia coli EC1868 tRNA-Cys
    731. Escherichia coli EC1869 tRNA-Cys
    732. Escherichia coli EC1870 tRNA-Cys
    733. Escherichia coli EC4013 tRNA-Cys
    734. Escherichia coli EC4196 tRNA-Cys
    735. Escherichia coli EC4203 tRNA-Cys
    736. Escherichia coli EC4402 tRNA-Cys
    737. Escherichia coli EC4421 tRNA-Cys
    738. Escherichia coli EC4422 tRNA-Cys
    739. Escherichia coli EC4436 tRNA-Cys
    740. Escherichia coli EC4437 tRNA-Cys
    741. Escherichia coli EC4439 tRNA-Cys
    742. Escherichia coli EC4448 tRNA-Cys
    743. Escherichia coli EC96038 tRNA-Cys
    744. Escherichia coli ECA-0157 tRNA-Cys
    745. Escherichia coli ECA-727 tRNA-Cys
    746. Escherichia coli ECC-1470 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    747. Escherichia coli ECC-Z tRNA-Cys
    748. Escherichia coli ED1a tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    749. Escherichia coli Envira 10/1 tRNA-Cys
    750. Escherichia coli Envira 8/11 tRNA-Cys
    751. Escherichia coli EPECa12 tRNA-Cys
    752. Escherichia coli EPECa14 tRNA-Cys
    753. Escherichia coli EPEC C342-62 tRNA-Cys
    754. Escherichia coli ER2796 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    755. Escherichia coli ETEC H10407 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    756. Escherichia coli FAP1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    757. Escherichia coli FDA504 tRNA-Cys
    758. Escherichia coli FDA505 tRNA-Cys
    759. Escherichia coli FDA506 tRNA-Cys
    760. Escherichia coli FDA507 tRNA-Cys
    761. Escherichia coli FDA517 tRNA-Cys
    762. Escherichia coli FRIK1985 tRNA-Cys
    763. Escherichia coli FRIK1990 tRNA-Cys
    764. Escherichia coli FRIK1996 tRNA-Cys
    765. Escherichia coli FRIK1997 tRNA-Cys
    766. Escherichia coli FRIK1999 tRNA-Cys
    767. Escherichia coli FRIK2001 tRNA-Cys
    768. Escherichia coli FRIK523 tRNA-Cys
    769. Escherichia coli FRIK920 tRNA-Cys
    770. Escherichia coli FVEC1302 tRNA-Cys
    771. Escherichia coli FVEC1412 tRNA-Cys
    772. Escherichia coli FVEC1465 tRNA-Cys
    773. Escherichia coli G3/10 tRNA-Cys
    774. Escherichia coli G58-1 tRNA-Cys
    775. Escherichia coli H001 tRNA-Cys
    776. Escherichia coli H120 tRNA-Cys
    777. Escherichia coli H20 tRNA-Cys
    778. Escherichia coli H223 tRNA-Cys
    779. Escherichia coli H252 tRNA-Cys
    780. Escherichia coli H263 tRNA-Cys
    781. Escherichia coli H296 tRNA-Cys
    782. Escherichia coli H299 tRNA-Cys
    783. Escherichia coli H305 tRNA-Cys
    784. Escherichia coli H378 tRNA-Cys
    785. Escherichia coli H383 tRNA-Cys
    786. Escherichia coli H386 tRNA-Cys
    787. Escherichia coli H397 tRNA-Cys
    788. Escherichia coli H413 tRNA-Cys
    789. Escherichia coli H420 tRNA-Cys
    790. Escherichia coli H454 tRNA-Cys
    791. Escherichia coli H461 tRNA-Cys
    792. Escherichia coli H489 tRNA-Cys
    793. Escherichia coli H494 tRNA-Cys
    794. Escherichia coli H588 tRNA-Cys
    795. Escherichia coli H591 tRNA-Cys
    796. Escherichia coli H605 tRNA-Cys
    797. Escherichia coli H617 tRNA-Cys
    798. Escherichia coli H730 tRNA-Cys
    799. Escherichia coli H736 tRNA-Cys
    800. Escherichia coli HM605 tRNA-Cys
    801. Escherichia coli HS tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    802. Escherichia coli HT115 tRNA-Cys
    803. Escherichia coli HVH 100 (4-2850729) tRNA-Cys
    804. Escherichia coli HVH 101 (4-6859844) tRNA-Cys
    805. Escherichia coli HVH 102 (4-6906788) tRNA-Cys
    806. Escherichia coli HVH 103 (4-5904188) tRNA-Cys
    807. Escherichia coli HVH 104 (4-6977960) (4-6977960) tRNA-Cys
    808. Escherichia coli HVH 10 (4-6832164) tRNA-Cys
    809. Escherichia coli HVH 106 (4-6881831) tRNA-Cys
    810. Escherichia coli HVH 107 (4-5860571) tRNA-Cys
    811. Escherichia coli HVH 108 (4-6924867) tRNA-Cys
    812. Escherichia coli HVH 109 (4-6977162) tRNA-Cys
    813. Escherichia coli HVH 110 (4-6978754) tRNA-Cys
    814. Escherichia coli HVH 111 (4-7039018) tRNA-Cys
    815. Escherichia coli HVH 112 (4-5987253) tRNA-Cys
    816. Escherichia coli HVH 113 (4-7535473) tRNA-Cys
    817. Escherichia coli HVH 114 (4-7037740) tRNA-Cys
    818. Escherichia coli HVH 115 (4-4465989) tRNA-Cys
    819. Escherichia coli HVH 115 (4-4465997) tRNA-Cys
    820. Escherichia coli HVH 116 (4-6879942) tRNA-Cys
    821. Escherichia coli HVH 117 (4-6857191) tRNA-Cys
    822. Escherichia coli HVH 118 (4-7345399) tRNA-Cys
    823. Escherichia coli HVH 119 (4-6879578) tRNA-Cys
    824. Escherichia coli HVH 120 (4-6978681) (4-6978681) tRNA-Cys
    825. Escherichia coli HVH 121 (4-6877826) tRNA-Cys
    826. Escherichia coli HVH 122 (4-6851606) tRNA-Cys
    827. Escherichia coli HVH 12 (4-7653042) tRNA-Cys
    828. Escherichia coli HVH 125 (4-2634716) tRNA-Cys
    829. Escherichia coli HVH 126 (4-6034225) tRNA-Cys
    830. Escherichia coli HVH 127 (4-7303629) tRNA-Cys
    831. Escherichia coli HVH 128 (4-7030436) (4-7030436) tRNA-Cys
    832. Escherichia coli HVH 130 (4-7036876) tRNA-Cys
    833. Escherichia coli HVH 132 (4-6876862) tRNA-Cys
    834. Escherichia coli HVH 133 (4-4466519) tRNA-Cys
    835. Escherichia coli HVH 134 (4-6073441) tRNA-Cys
    836. Escherichia coli HVH 13 (4-7634056) (4-7634056) tRNA-Cys
    837. Escherichia coli HVH 135 (4-4449320) tRNA-Cys
    838. Escherichia coli HVH 136 (4-5970458) tRNA-Cys
    839. Escherichia coli HVH 137 (4-2124971) tRNA-Cys
    840. Escherichia coli HVH 138 (4-6066704) tRNA-Cys
    841. Escherichia coli HVH 139 (4-3192644) tRNA-Cys
    842. Escherichia coli HVH 140 (4-5894387) tRNA-Cys
    843. Escherichia coli HVH 141 (4-5995973) (4-5995973) tRNA-Cys
    844. Escherichia coli HVH 142 (4-5627451) tRNA-Cys
    845. Escherichia coli HVH 143 (4-5674999) (4-5674999) tRNA-Cys
    846. Escherichia coli HVH 144 (4-4451937) tRNA-Cys
    847. Escherichia coli HVH 145 (4-5672112) (4-5672112) tRNA-Cys
    848. Escherichia coli HVH 146 (4-3189767) tRNA-Cys
    849. Escherichia coli HVH 1 (4-6876161) tRNA-Cys
    850. Escherichia coli HVH 147 (4-5893887) tRNA-Cys
    851. Escherichia coli HVH 148 (4-3192490) tRNA-Cys
    852. Escherichia coli HVH 149 (4-4451880) tRNA-Cys
    853. Escherichia coli HVH 150 (4-3258106) tRNA-Cys
    854. Escherichia coli HVH 151 (4-5755573) tRNA-Cys
    855. Escherichia coli HVH 152 (4-3447545) tRNA-Cys
    856. Escherichia coli HVH 153 (3-9344314) tRNA-Cys
    857. Escherichia coli HVH 154 (4-5636698) tRNA-Cys
    858. Escherichia coli HVH 155 (4-4509048) tRNA-Cys
    859. Escherichia coli HVH 156 (4-3206505) tRNA-Cys
    860. Escherichia coli HVH 157 (4-3406229) tRNA-Cys
    861. Escherichia coli HVH 158 (4-3224287) (4-3224287) tRNA-Cys
    862. Escherichia coli HVH 159 (4-5818141) tRNA-Cys
    863. Escherichia coli HVH 160 (4-5695937) (4-5695937) tRNA-Cys
    864. Escherichia coli HVH 161 (4-3119890) tRNA-Cys
    865. Escherichia coli HVH 162 (4-5627982) tRNA-Cys
    866. Escherichia coli HVH 163 (4-4697553) (4-4697553) tRNA-Cys
    867. Escherichia coli HVH 164 (4-5953081) tRNA-Cys
    868. Escherichia coli HVH 16 (4-7649002) tRNA-Cys
    869. Escherichia coli HVH 167 (4-6073565) tRNA-Cys
    870. Escherichia coli HVH 169 (4-1075578) tRNA-Cys
    871. Escherichia coli HVH 170 (4-3026949) tRNA-Cys
    872. Escherichia coli HVH 171 (4-3191958) tRNA-Cys
    873. Escherichia coli HVH 172 (4-3248542) tRNA-Cys
    874. Escherichia coli HVH 173 (3-9175482) tRNA-Cys
    875. Escherichia coli HVH 17 (4-7473087) tRNA-Cys
    876. Escherichia coli HVH 175 (4-3405184) tRNA-Cys
    877. Escherichia coli HVH 176 (4-3428664) tRNA-Cys
    878. Escherichia coli HVH 177 (4-2876612) tRNA-Cys
    879. Escherichia coli HVH 178 (4-3189163) (4-3189163) tRNA-Cys
    880. Escherichia coli HVH 180 (4-3051617) (4-3051617) tRNA-Cys
    881. Escherichia coli HVH 182 (4-0985554) tRNA-Cys
    882. Escherichia coli HVH 183 (4-3205932) tRNA-Cys
    883. Escherichia coli HVH 184 (4-3343286) (4-3343286) tRNA-Cys
    884. Escherichia coli HVH 18 (4-8589585) tRNA-Cys
    885. Escherichia coli HVH 185 (4-2876639) tRNA-Cys
    886. Escherichia coli HVH 186 (4-3405044) tRNA-Cys
    887. Escherichia coli HVH 187 (4-4471660) tRNA-Cys
    888. Escherichia coli HVH 188 (4-2356988) tRNA-Cys
    889. Escherichia coli HVH 189 (4-3220125) tRNA-Cys
    890. Escherichia coli HVH 190 (4-3255514) tRNA-Cys
    891. Escherichia coli HVH 191 (3-9341900) tRNA-Cys
    892. Escherichia coli HVH 192 (4-3054470) (4-3054470) tRNA-Cys
    893. Escherichia coli HVH 193 (4-3331423) tRNA-Cys
    894. Escherichia coli HVH 194 (4-2356805) tRNA-Cys
    895. Escherichia coli HVH 19 (4-7154984) tRNA-Cys
    896. Escherichia coli HVH 195 (3-7155360) tRNA-Cys
    897. Escherichia coli HVH 196 (4-4530470) tRNA-Cys
    898. Escherichia coli HVH 197 (4-4466217) tRNA-Cys
    899. Escherichia coli HVH 198 (4-3206106) tRNA-Cys
    900. Escherichia coli HVH 199 (4-5670322) tRNA-Cys
    901. Escherichia coli HVH 200 (4-4449924) tRNA-Cys
    902. Escherichia coli HVH 201 (4-4459431) tRNA-Cys
    903. Escherichia coli HVH 202 (4-3163997) tRNA-Cys
    904. Escherichia coli HVH 203 (4-3126218) tRNA-Cys
    905. Escherichia coli HVH 204 (4-3112802) tRNA-Cys
    906. Escherichia coli HVH 20 (4-5865042) tRNA-Cys
    907. Escherichia coli HVH 205 (4-3094677) tRNA-Cys
    908. Escherichia coli HVH 206 (4-3128229) tRNA-Cys
    909. Escherichia coli HVH 207 (4-3113221) tRNA-Cys
    910. Escherichia coli HVH 208 (4-3112292) tRNA-Cys
    911. Escherichia coli HVH 209 (4-3062651) tRNA-Cys
    912. Escherichia coli HVH 210 (4-3042480) tRNA-Cys
    913. Escherichia coli HVH 211 (4-3041891) tRNA-Cys
    914. Escherichia coli HVH 212 (3-9305343) (3-9305343) tRNA-Cys
    915. Escherichia coli HVH 213 (4-3042928) (4-3042928) tRNA-Cys
    916. Escherichia coli HVH 214 (4-3062198) tRNA-Cys
    917. Escherichia coli HVH 21 (4-4517873) tRNA-Cys
    918. Escherichia coli HVH 215 (4-3008371) tRNA-Cys
    919. Escherichia coli HVH 216 (4-3042952) tRNA-Cys
    920. Escherichia coli HVH 217 (4-1022806) tRNA-Cys
    921. Escherichia coli HVH 218 (4-4500903) tRNA-Cys
    922. Escherichia coli HVH 220 (4-5876842) tRNA-Cys
    923. Escherichia coli HVH 221 (4-3136817) tRNA-Cys
    924. Escherichia coli HVH 222 (4-2977443) tRNA-Cys
    925. Escherichia coli HVH 223 (4-2976528) (4-2976528) tRNA-Cys
    926. Escherichia coli HVH 22 (4-2258986) tRNA-Cys
    927. Escherichia coli HVH 225 (4-1273116) tRNA-Cys
    928. Escherichia coli HVH 227 (4-2277670) tRNA-Cys
    929. Escherichia coli HVH 228 (4-7787030) (4-7787030) tRNA-Cys
    930. Escherichia coli HVH 23 (4-6066488) tRNA-Cys
    931. Escherichia coli HVH 24 (4-5985145) tRNA-Cys
    932. Escherichia coli HVH 2 (4-6943160) (4-6943160) tRNA-Cys
    933. Escherichia coli HVH 25 (4-5851939) tRNA-Cys
    934. Escherichia coli HVH 26 (4-5703913) tRNA-Cys
    935. Escherichia coli HVH 27 (4-7449267) tRNA-Cys
    936. Escherichia coli HVH 28 (4-0907367) tRNA-Cys
    937. Escherichia coli HVH 29 (4-3418073) tRNA-Cys
    938. Escherichia coli HVH 30 (4-2661829) tRNA-Cys
    939. Escherichia coli HVH 31 (4-2602156) tRNA-Cys
    940. Escherichia coli HVH 32 (4-3773988) tRNA-Cys
    941. Escherichia coli HVH 33 (4-2174936) tRNA-Cys
    942. Escherichia coli HVH 3 (4-7276001) tRNA-Cys
    943. Escherichia coli HVH 35 (4-2962667) (4-2962667) tRNA-Cys
    944. Escherichia coli HVH 36 (4-5675286) tRNA-Cys
    945. Escherichia coli HVH 37 (4-2773848) (4-2773848) tRNA-Cys
    946. Escherichia coli HVH 38 (4-2774682) tRNA-Cys
    947. Escherichia coli HVH 39 (4-2679949) tRNA-Cys
    948. Escherichia coli HVH 40 (4-1219782) tRNA-Cys
    949. Escherichia coli HVH 41 (4-2677849) tRNA-Cys
    950. Escherichia coli HVH 42 (4-2100061) tRNA-Cys
    951. Escherichia coli HVH 43 (4-2173468) tRNA-Cys
    952. Escherichia coli HVH 44 (4-2298570) tRNA-Cys
    953. Escherichia coli HVH 4 (4-7276109) tRNA-Cys
    954. Escherichia coli HVH 45 (4-3129918) tRNA-Cys
    955. Escherichia coli HVH 46 (4-2758776) tRNA-Cys
    956. Escherichia coli HVH 48 (4-2658593) tRNA-Cys
    957. Escherichia coli HVH 50 (4-2593475) tRNA-Cys
    958. Escherichia coli HVH 51 (4-2172526) tRNA-Cys
    959. Escherichia coli HVH 53 (4-0631051) tRNA-Cys
    960. Escherichia coli HVH 54 (4-2723514) tRNA-Cys
    961. Escherichia coli HVH 5 (4-7148410) (4-7148410) tRNA-Cys
    962. Escherichia coli HVH 55 (4-2646161) tRNA-Cys
    963. Escherichia coli HVH 56 (4-2153033) tRNA-Cys
    964. Escherichia coli HVH 58 (4-2839709) tRNA-Cys
    965. Escherichia coli HVH 59 (4-1119338) tRNA-Cys
    966. Escherichia coli HVH 61 (4-2736020) (4-2736020) tRNA-Cys
    967. Escherichia coli HVH 63 (4-2542528) tRNA-Cys
    968. Escherichia coli HVH 6 (3-8296502) tRNA-Cys
    969. Escherichia coli HVH 65 (4-2262045) tRNA-Cys
    970. Escherichia coli HVH 68 (4-0888028) tRNA-Cys
    971. Escherichia coli HVH 69 (4-2837072) tRNA-Cys
    972. Escherichia coli HVH 70 (4-2963531) tRNA-Cys
    973. Escherichia coli HVH 73 (4-2393174) tRNA-Cys
    974. Escherichia coli HVH 74 (4-1034782) tRNA-Cys
    975. Escherichia coli HVH 7 (4-7315031) tRNA-Cys
    976. Escherichia coli HVH 76 (4-2538717) tRNA-Cys
    977. Escherichia coli HVH 77 (4-2605759) tRNA-Cys
    978. Escherichia coli HVH 78 (4-2735946) tRNA-Cys
    979. Escherichia coli HVH 79 (4-2512823) (4-2512823) tRNA-Cys
    980. Escherichia coli HVH 80 (4-2428830) tRNA-Cys
    981. Escherichia coli HVH 82 (4-2209276) tRNA-Cys
    982. Escherichia coli HVH 83 (4-2051087) (4-2051087) tRNA-Cys
    983. Escherichia coli HVH 84 (4-1021478) tRNA-Cys
    984. Escherichia coli HVH 85 (4-0792144) tRNA-Cys
    985. Escherichia coli HVH 86 (4-7026218) tRNA-Cys
    986. Escherichia coli HVH 87 (4-5977630) tRNA-Cys
    987. Escherichia coli HVH 88 (4-5854636) tRNA-Cys
    988. Escherichia coli HVH 89 (4-5885604) tRNA-Cys
    989. Escherichia coli HVH 90 (4-3191362) tRNA-Cys
    990. Escherichia coli HVH 91 (4-4638751) tRNA-Cys
    991. Escherichia coli HVH 92 (4-5930790) tRNA-Cys
    992. Escherichia coli HVH 93 (4-5851025) tRNA-Cys
    993. Escherichia coli HVH 9 (4-6942539) (4-6942539) tRNA-Cys
    994. Escherichia coli HVH 95 (4-6074464) (4-6074464) tRNA-Cys
    995. Escherichia coli HVH 96 (4-5934869) tRNA-Cys
    996. Escherichia coli HVH 98 (4-5799287) (4-5799287) tRNA-Cys
    997. Escherichia coli IAI1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    998. Escherichia coli IAI39 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    999. Escherichia coli IHE3034 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1000. Escherichia coli J53 tRNA-Cys
    1001. Escherichia coli J96 tRNA-Cys
    1002. Escherichia coli JB1-95 tRNA-Cys
    1003. Escherichia coli JJ1886 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1004. Escherichia coli JJ1887 tRNA-Cys
    1005. Escherichia coli Jurua 18/11 tRNA-Cys
    1006. Escherichia coli Jurua 20/10 tRNA-Cys
    1007. Escherichia coli K02 tRNA-Cys
    1008. Escherichia coli K-12 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1009. Escherichia coli K71 tRNA-Cys
    1010. Escherichia coli KD1 tRNA-Cys
    1011. Escherichia coli KD2 tRNA-Cys
    1012. Escherichia coli KLY tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1013. Escherichia coli KO11FL tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1014. Escherichia coli KOEGE 10 (25a) tRNA-Cys
    1015. Escherichia coli KOEGE 118 (317a) tRNA-Cys
    1016. Escherichia coli KOEGE 131 (358a) tRNA-Cys
    1017. Escherichia coli KOEGE 30 (63a) tRNA-Cys
    1018. Escherichia coli KOEGE 32 (66a) tRNA-Cys
    1019. Escherichia coli KOEGE 33 (68a) (68a) tRNA-Cys
    1020. Escherichia coli KOEGE 3 (4a) tRNA-Cys
    1021. Escherichia coli KOEGE 40 (102a) tRNA-Cys
    1022. Escherichia coli KOEGE 43 (105a) tRNA-Cys
    1023. Escherichia coli KOEGE 44 (106a) tRNA-Cys
    1024. Escherichia coli KOEGE 56 (169a) tRNA-Cys
    1025. Escherichia coli KOEGE 58 (171a) tRNA-Cys
    1026. Escherichia coli KOEGE 61 (174a) tRNA-Cys
    1027. Escherichia coli KOEGE 62 (175a) tRNA-Cys
    1028. Escherichia coli KOEGE 68 (182a) tRNA-Cys
    1029. Escherichia coli KOEGE 70 (185a) tRNA-Cys
    1030. Escherichia coli KOEGE 71 (186a) tRNA-Cys
    1031. Escherichia coli KOEGE 7 (16a) tRNA-Cys
    1032. Escherichia coli KOEGE 73 (195a) tRNA-Cys
    1033. Escherichia coli KOEGE 77 (202a) tRNA-Cys
    1034. Escherichia coli KTE100 tRNA-Cys
    1035. Escherichia coli KTE101 tRNA-Cys
    1036. Escherichia coli KTE102 tRNA-Cys
    1037. Escherichia coli KTE103 tRNA-Cys
    1038. Escherichia coli KTE104 tRNA-Cys
    1039. Escherichia coli KTE105 tRNA-Cys
    1040. Escherichia coli KTE106 tRNA-Cys
    1041. Escherichia coli KTE107 tRNA-Cys
    1042. Escherichia coli KTE108 tRNA-Cys
    1043. Escherichia coli KTE109 tRNA-Cys
    1044. Escherichia coli KTE10 tRNA-Cys
    1045. Escherichia coli KTE111 tRNA-Cys
    1046. Escherichia coli KTE112 tRNA-Cys
    1047. Escherichia coli KTE113 tRNA-Cys
    1048. Escherichia coli KTE115 tRNA-Cys
    1049. Escherichia coli KTE116 tRNA-Cys
    1050. Escherichia coli KTE117 tRNA-Cys
    1051. Escherichia coli KTE118 tRNA-Cys
    1052. Escherichia coli KTE119 tRNA-Cys
    1053. Escherichia coli KTE120 tRNA-Cys
    1054. Escherichia coli KTE121 tRNA-Cys
    1055. Escherichia coli KTE122 tRNA-Cys
    1056. Escherichia coli KTE123 tRNA-Cys
    1057. Escherichia coli KTE124 tRNA-Cys
    1058. Escherichia coli KTE125 tRNA-Cys
    1059. Escherichia coli KTE126 tRNA-Cys
    1060. Escherichia coli KTE127 tRNA-Cys
    1061. Escherichia coli KTE128 tRNA-Cys
    1062. Escherichia coli KTE129 tRNA-Cys
    1063. Escherichia coli KTE12 tRNA-Cys
    1064. Escherichia coli KTE130 tRNA-Cys
    1065. Escherichia coli KTE131 tRNA-Cys
    1066. Escherichia coli KTE132 tRNA-Cys
    1067. Escherichia coli KTE133 tRNA-Cys
    1068. Escherichia coli KTE134 tRNA-Cys
    1069. Escherichia coli KTE135 tRNA-Cys
    1070. Escherichia coli KTE136 tRNA-Cys
    1071. Escherichia coli KTE137 tRNA-Cys
    1072. Escherichia coli KTE138 tRNA-Cys
    1073. Escherichia coli KTE139 tRNA-Cys
    1074. Escherichia coli KTE13 tRNA-Cys
    1075. Escherichia coli KTE140 tRNA-Cys
    1076. Escherichia coli KTE141 tRNA-Cys
    1077. Escherichia coli KTE142 tRNA-Cys
    1078. Escherichia coli KTE143 tRNA-Cys
    1079. Escherichia coli KTE144 tRNA-Cys
    1080. Escherichia coli KTE145 tRNA-Cys
    1081. Escherichia coli KTE146 tRNA-Cys
    1082. Escherichia coli KTE147 tRNA-Cys
    1083. Escherichia coli KTE148 tRNA-Cys
    1084. Escherichia coli KTE14 tRNA-Cys
    1085. Escherichia coli KTE150 tRNA-Cys
    1086. Escherichia coli KTE153 tRNA-Cys
    1087. Escherichia coli KTE154 tRNA-Cys
    1088. Escherichia coli KTE155 tRNA-Cys
    1089. Escherichia coli KTE156 tRNA-Cys
    1090. Escherichia coli KTE157 tRNA-Cys
    1091. Escherichia coli KTE158 tRNA-Cys
    1092. Escherichia coli KTE15 tRNA-Cys
    1093. Escherichia coli KTE160 tRNA-Cys
    1094. Escherichia coli KTE161 tRNA-Cys
    1095. Escherichia coli KTE162 tRNA-Cys
    1096. Escherichia coli KTE163 tRNA-Cys
    1097. Escherichia coli KTE165 tRNA-Cys
    1098. Escherichia coli KTE166 tRNA-Cys
    1099. Escherichia coli KTE167 tRNA-Cys
    1100. Escherichia coli KTE168 tRNA-Cys
    1101. Escherichia coli KTE169 tRNA-Cys
    1102. Escherichia coli KTE16 tRNA-Cys
    1103. Escherichia coli KTE170 tRNA-Cys
    1104. Escherichia coli KTE171 tRNA-Cys
    1105. Escherichia coli KTE173 tRNA-Cys
    1106. Escherichia coli KTE174 tRNA-Cys
    1107. Escherichia coli KTE175 tRNA-Cys
    1108. Escherichia coli KTE176 tRNA-Cys
    1109. Escherichia coli KTE177 tRNA-Cys
    1110. Escherichia coli KTE178 tRNA-Cys
    1111. Escherichia coli KTE179 tRNA-Cys
    1112. Escherichia coli KTE17 tRNA-Cys
    1113. Escherichia coli KTE180 tRNA-Cys
    1114. Escherichia coli KTE181 tRNA-Cys
    1115. Escherichia coli KTE182 tRNA-Cys
    1116. Escherichia coli KTE183 tRNA-Cys
    1117. Escherichia coli KTE184 tRNA-Cys
    1118. Escherichia coli KTE185 tRNA-Cys
    1119. Escherichia coli KTE186 tRNA-Cys
    1120. Escherichia coli KTE187 tRNA-Cys
    1121. Escherichia coli KTE188 tRNA-Cys
    1122. Escherichia coli KTE189 tRNA-Cys
    1123. Escherichia coli KTE18 tRNA-Cys
    1124. Escherichia coli KTE190 tRNA-Cys
    1125. Escherichia coli KTE191 tRNA-Cys
    1126. Escherichia coli KTE192 tRNA-Cys
    1127. Escherichia coli KTE193 tRNA-Cys
    1128. Escherichia coli KTE194 tRNA-Cys
    1129. Escherichia coli KTE195 tRNA-Cys
    1130. Escherichia coli KTE196 tRNA-Cys
    1131. Escherichia coli KTE197 tRNA-Cys
    1132. Escherichia coli KTE198 tRNA-Cys
    1133. Escherichia coli KTE199 tRNA-Cys
    1134. Escherichia coli KTE19 tRNA-Cys
    1135. Escherichia coli KTE1 tRNA-Cys
    1136. Escherichia coli KTE200 tRNA-Cys
    1137. Escherichia coli KTE201 tRNA-Cys
    1138. Escherichia coli KTE202 tRNA-Cys
    1139. Escherichia coli KTE203 tRNA-Cys
    1140. Escherichia coli KTE204 tRNA-Cys
    1141. Escherichia coli KTE205 tRNA-Cys
    1142. Escherichia coli KTE206 tRNA-Cys
    1143. Escherichia coli KTE207 tRNA-Cys
    1144. Escherichia coli KTE208 tRNA-Cys
    1145. Escherichia coli KTE209 tRNA-Cys
    1146. Escherichia coli KTE20 tRNA-Cys
    1147. Escherichia coli KTE210 tRNA-Cys
    1148. Escherichia coli KTE211 tRNA-Cys
    1149. Escherichia coli KTE212 tRNA-Cys
    1150. Escherichia coli KTE213 tRNA-Cys
    1151. Escherichia coli KTE214 tRNA-Cys
    1152. Escherichia coli KTE215 tRNA-Cys
    1153. Escherichia coli KTE216 tRNA-Cys
    1154. Escherichia coli KTE217 tRNA-Cys
    1155. Escherichia coli KTE218 tRNA-Cys
    1156. Escherichia coli KTE219 tRNA-Cys
    1157. Escherichia coli KTE21 tRNA-Cys
    1158. Escherichia coli KTE220 tRNA-Cys
    1159. Escherichia coli KTE221 tRNA-Cys
    1160. Escherichia coli KTE222 tRNA-Cys
    1161. Escherichia coli KTE223 tRNA-Cys
    1162. Escherichia coli KTE224 tRNA-Cys
    1163. Escherichia coli KTE225 tRNA-Cys
    1164. Escherichia coli KTE226 tRNA-Cys
    1165. Escherichia coli KTE227 tRNA-Cys
    1166. Escherichia coli KTE228 tRNA-Cys
    1167. Escherichia coli KTE229 tRNA-Cys
    1168. Escherichia coli KTE22 tRNA-Cys
    1169. Escherichia coli KTE230 tRNA-Cys
    1170. Escherichia coli KTE231 tRNA-Cys
    1171. Escherichia coli KTE232 tRNA-Cys
    1172. Escherichia coli KTE233 tRNA-Cys
    1173. Escherichia coli KTE234 tRNA-Cys
    1174. Escherichia coli KTE235 tRNA-Cys
    1175. Escherichia coli KTE236 tRNA-Cys
    1176. Escherichia coli KTE237 tRNA-Cys
    1177. Escherichia coli KTE23 tRNA-Cys
    1178. Escherichia coli KTE240 tRNA-Cys
    1179. Escherichia coli KTE24 tRNA-Cys
    1180. Escherichia coli KTE25 tRNA-Cys
    1181. Escherichia coli KTE26 tRNA-Cys
    1182. Escherichia coli KTE27 tRNA-Cys
    1183. Escherichia coli KTE28 tRNA-Cys
    1184. Escherichia coli KTE29 tRNA-Cys
    1185. Escherichia coli KTE2 tRNA-Cys
    1186. Escherichia coli KTE33 tRNA-Cys
    1187. Escherichia coli KTE34 tRNA-Cys
    1188. Escherichia coli KTE35 tRNA-Cys
    1189. Escherichia coli KTE36 tRNA-Cys
    1190. Escherichia coli KTE37 tRNA-Cys
    1191. Escherichia coli KTE38 tRNA-Cys
    1192. Escherichia coli KTE39 tRNA-Cys
    1193. Escherichia coli KTE3 tRNA-Cys
    1194. Escherichia coli KTE40 tRNA-Cys
    1195. Escherichia coli KTE41 tRNA-Cys
    1196. Escherichia coli KTE42 tRNA-Cys
    1197. Escherichia coli KTE43 tRNA-Cys
    1198. Escherichia coli KTE44 tRNA-Cys
    1199. Escherichia coli KTE45 tRNA-Cys
    1200. Escherichia coli KTE46 tRNA-Cys
    1201. Escherichia coli KTE47 tRNA-Cys
    1202. Escherichia coli KTE48 tRNA-Cys
    1203. Escherichia coli KTE49 tRNA-Cys
    1204. Escherichia coli KTE4 tRNA-Cys
    1205. Escherichia coli KTE50 tRNA-Cys
    1206. Escherichia coli KTE51 tRNA-Cys
    1207. Escherichia coli KTE53 tRNA-Cys
    1208. Escherichia coli KTE54 tRNA-Cys
    1209. Escherichia coli KTE55 tRNA-Cys
    1210. Escherichia coli KTE56 tRNA-Cys
    1211. Escherichia coli KTE57 tRNA-Cys
    1212. Escherichia coli KTE58 tRNA-Cys
    1213. Escherichia coli KTE59 tRNA-Cys
    1214. Escherichia coli KTE5 tRNA-Cys
    1215. Escherichia coli KTE60 tRNA-Cys
    1216. Escherichia coli KTE61 tRNA-Cys
    1217. Escherichia coli KTE62 tRNA-Cys
    1218. Escherichia coli KTE63 tRNA-Cys
    1219. Escherichia coli KTE64 tRNA-Cys
    1220. Escherichia coli KTE65 tRNA-Cys
    1221. Escherichia coli KTE66 tRNA-Cys
    1222. Escherichia coli KTE67 tRNA-Cys
    1223. Escherichia coli KTE68 tRNA-Cys
    1224. Escherichia coli KTE69 tRNA-Cys
    1225. Escherichia coli KTE6 tRNA-Cys
    1226. Escherichia coli KTE70 tRNA-Cys
    1227. Escherichia coli KTE71 tRNA-Cys
    1228. Escherichia coli KTE72 tRNA-Cys
    1229. Escherichia coli KTE73 tRNA-Cys
    1230. Escherichia coli KTE74 tRNA-Cys
    1231. Escherichia coli KTE75 tRNA-Cys
    1232. Escherichia coli KTE76 tRNA-Cys
    1233. Escherichia coli KTE77 tRNA-Cys
    1234. Escherichia coli KTE78 tRNA-Cys
    1235. Escherichia coli KTE79 tRNA-Cys
    1236. Escherichia coli KTE7 tRNA-Cys
    1237. Escherichia coli KTE80 tRNA-Cys
    1238. Escherichia coli KTE81 tRNA-Cys
    1239. Escherichia coli KTE82 tRNA-Cys
    1240. Escherichia coli KTE83 tRNA-Cys
    1241. Escherichia coli KTE84 tRNA-Cys
    1242. Escherichia coli KTE85 tRNA-Cys
    1243. Escherichia coli KTE86 tRNA-Cys
    1244. Escherichia coli KTE87 tRNA-Cys
    1245. Escherichia coli KTE88 tRNA-Cys
    1246. Escherichia coli KTE89 tRNA-Cys
    1247. Escherichia coli KTE8 tRNA-Cys
    1248. Escherichia coli KTE90 tRNA-Cys
    1249. Escherichia coli KTE91 tRNA-Cys
    1250. Escherichia coli KTE93 tRNA-Cys
    1251. Escherichia coli KTE94 tRNA-Cys
    1252. Escherichia coli KTE95 tRNA-Cys
    1253. Escherichia coli KTE97 tRNA-Cys
    1254. Escherichia coli KTE98 tRNA-Cys
    1255. Escherichia coli KTE99 tRNA-Cys
    1256. Escherichia coli KTE9 tRNA-Cys
    1257. Escherichia coli LAU-EC10 tRNA-Cys
    1258. Escherichia coli LAU-EC6 tRNA-Cys
    1259. Escherichia coli LAU-EC7 tRNA-Cys
    1260. Escherichia coli LAU-EC8 tRNA-Cys
    1261. Escherichia coli LAU-EC9 tRNA-Cys
    1262. Escherichia coli LF82 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1263. Escherichia coli LT-68 tRNA-Cys
    1264. Escherichia coli LY180 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1265. Escherichia coli M056 tRNA-Cys
    1266. Escherichia coli M114 tRNA-Cys
    1267. Escherichia coli M12 tRNA-Cys
    1268. Escherichia coli M4 tRNA-Cys
    1269. Escherichia coli M605 tRNA-Cys
    1270. Escherichia coli M718 tRNA-Cys
    1271. Escherichia coli M863 tRNA-Cys
    1272. Escherichia coli M8 tRNA-Cys
    1273. Escherichia coli M919 tRNA-Cys
    1274. Escherichia coli MA6 tRNA-Cys
    1275. Escherichia coli MGH 57 tRNA-Cys
    1276. Escherichia coli MGH 58 tRNA-Cys
    1277. Escherichia coli MP020940.1 tRNA-Cys
    1278. Escherichia coli MP020980.1 tRNA-Cys
    1279. Escherichia coli MP020980.2 tRNA-Cys
    1280. Escherichia coli MP021017.10 tRNA-Cys
    1281. Escherichia coli MP021017.11 tRNA-Cys
    1282. Escherichia coli MP021017.12 tRNA-Cys
    1283. Escherichia coli MP021017.1 tRNA-Cys
    1284. Escherichia coli MP021017.2 tRNA-Cys
    1285. Escherichia coli MP021017.3 tRNA-Cys
    1286. Escherichia coli MP021017.4 tRNA-Cys
    1287. Escherichia coli MP021017.5 tRNA-Cys
    1288. Escherichia coli MP021017.6 tRNA-Cys
    1289. Escherichia coli MP021017.9 tRNA-Cys
    1290. Escherichia coli MP021552.11 tRNA-Cys
    1291. Escherichia coli MP021552.12 tRNA-Cys
    1292. Escherichia coli MP021552.7 tRNA-Cys
    1293. Escherichia coli MP021552.8 tRNA-Cys
    1294. Escherichia coli MP021561.2 tRNA-Cys
    1295. Escherichia coli MP021561.3 tRNA-Cys
    1296. Escherichia coli MP021566.1 tRNA-Cys
    1297. Escherichia coli MP1 tRNA-Cys
    1298. Escherichia coli MRSN 10204 tRNA-Cys
    1299. Escherichia coli MS 107-1 tRNA-Cys
    1300. Escherichia coli MS 110-3 tRNA-Cys
    1301. Escherichia coli MS 115-1 tRNA-Cys
    1302. Escherichia coli MS 116-1 tRNA-Cys
    1303. Escherichia coli MS 117-3 tRNA-Cys
    1304. Escherichia coli MS 119-7 tRNA-Cys
    1305. Escherichia coli MS 124-1 tRNA-Cys
    1306. Escherichia coli MS 145-7 tRNA-Cys
    1307. Escherichia coli MS 146-1 tRNA-Cys
    1308. Escherichia coli MS 153-1 tRNA-Cys
    1309. Escherichia coli MS 16-3 tRNA-Cys
    1310. Escherichia coli MS 175-1 tRNA-Cys
    1311. Escherichia coli MS 182-1 tRNA-Cys
    1312. Escherichia coli MS 185-1 tRNA-Cys
    1313. Escherichia coli MS 187-1 tRNA-Cys
    1314. Escherichia coli MS 196-1 tRNA-Cys
    1315. Escherichia coli MS 198-1 tRNA-Cys
    1316. Escherichia coli MS 200-1 tRNA-Cys
    1317. Escherichia coli MS 21-1 tRNA-Cys
    1318. Escherichia coli MS 45-1 tRNA-Cys
    1319. Escherichia coli MS 57-2 tRNA-Cys
    1320. Escherichia coli MS 60-1 tRNA-Cys
    1321. Escherichia coli MS 69-1 tRNA-Cys
    1322. Escherichia coli MS 78-1 tRNA-Cys
    1323. Escherichia coli MS 79-10 tRNA-Cys
    1324. Escherichia coli MS 84-1 tRNA-Cys
    1325. Escherichia coli MS 85-1 tRNA-Cys
    1326. Escherichia coli N1 tRNA-Cys
    1327. Escherichia coli N36254PS tRNA-Cys
    1328. Escherichia coli N36410PS tRNA-Cys
    1329. Escherichia coli N37058PS tRNA-Cys
    1330. Escherichia coli N37122PS tRNA-Cys
    1331. Escherichia coli N37139PS tRNA-Cys
    1332. Escherichia coli N40513 tRNA-Cys
    1333. Escherichia coli N40607 tRNA-Cys
    1334. Escherichia coli NA114 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1335. Escherichia coli NB8 tRNA-Cys
    1336. Escherichia coli NC101 tRNA-Cys
    1337. Escherichia coli NCCP15648 tRNA-Cys
    1338. Escherichia coli NCTC 50110 tRNA-Cys
    1339. Escherichia coli NE037 tRNA-Cys
    1340. Escherichia coli NE098 tRNA-Cys
    1341. Escherichia coli NE1487 tRNA-Cys
    1342. Escherichia coli Nissle 1917 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1343. Escherichia coli NU14 tRNA-Cys
    1344. Escherichia coli O08 tRNA-Cys
    1345. Escherichia coli O100:H21 tRNA-Cys
    1346. Escherichia coli O100 tRNA-Cys
    1347. Escherichia coli O101 tRNA-Cys
    1348. Escherichia coli O103:H11 str. 04-3023 tRNA-Cys
    1349. Escherichia coli O103:H11 str. 2010C-3214 tRNA-Cys
    1350. Escherichia coli O103:H25 str. 2010C-4529 tRNA-Cys
    1351. Escherichia coli O103:H25 str. CVM9340 tRNA-Cys
    1352. Escherichia coli O103:H2 str. 12009 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1353. Escherichia coli O103:H2 str. 2009C-3279 tRNA-Cys
    1354. Escherichia coli O103:H2 str. 2010C-4433 tRNA-Cys
    1355. Escherichia coli O103:H2 str. 2011C-3750 tRNA-Cys
    1356. Escherichia coli O103:H2 str. CVM9450 tRNA-Cys
    1357. Escherichia coli O103:H2 tRNA-Cys
    1358. Escherichia coli O103 str. RM8385 tRNA-Cys
    1359. Escherichia coli O103 tRNA-Cys
    1360. Escherichia coli O104:H21 str. 94-3025 tRNA-Cys
    1361. Escherichia coli O104:H21 str. CFSAN002236 tRNA-Cys
    1362. Escherichia coli O104:H21 str. CFSAN002237 tRNA-Cys
    1363. Escherichia coli O104:H4 str. 01-09591 tRNA-Cys
    1364. Escherichia coli O104:H4 str. 04-8351 tRNA-Cys
    1365. Escherichia coli O104:H4 str. 09-7901 tRNA-Cys
    1366. Escherichia coli O104:H4 str. 11-02030 tRNA-Cys
    1367. Escherichia coli O104:H4 str. 11-02033-1 tRNA-Cys
    1368. Escherichia coli O104:H4 str. 11-02092 tRNA-Cys
    1369. Escherichia coli O104:H4 str. 11-02093 tRNA-Cys
    1370. Escherichia coli O104:H4 str. 11-02281 tRNA-Cys
    1371. Escherichia coli O104:H4 str. 11-02318 tRNA-Cys
    1372. Escherichia coli O104:H4 str. 11-02913 tRNA-Cys
    1373. Escherichia coli O104:H4 str. 11-03439 tRNA-Cys
    1374. Escherichia coli O104:H4 str. 11-03943 tRNA-Cys
    1375. Escherichia coli O104:H4 str. 11-04080 tRNA-Cys
    1376. Escherichia coli O104:H4 str. 11-3677 tRNA-Cys
    1377. Escherichia coli O104:H4 str. 11-4404 tRNA-Cys
    1378. Escherichia coli O104:H4 str. 11-4522 tRNA-Cys
    1379. Escherichia coli O104:H4 str. 11-4623 tRNA-Cys
    1380. Escherichia coli O104:H4 str. 11-4632 C1 tRNA-Cys
    1381. Escherichia coli O104:H4 str. 11-4632 C2 tRNA-Cys
    1382. Escherichia coli O104:H4 str. 11-4632 C3 tRNA-Cys
    1383. Escherichia coli O104:H4 str. 11-4632 C4 tRNA-Cys
    1384. Escherichia coli O104:H4 str. 11-4632 C5 tRNA-Cys
    1385. Escherichia coli O104:H4 str. 2009EL-2050 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1386. Escherichia coli O104:H4 str. 2009EL-2071 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1387. Escherichia coli O104:H4 str. 2011C-3493 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1388. Escherichia coli O104:H4 str. 2011EL-1675A tRNA-Cys
    1389. Escherichia coli O104:H4 str. C227-11 tRNA-Cys
    1390. Escherichia coli O104:H4 str. C236-11 tRNA-Cys
    1391. Escherichia coli O104:H4 str. E112/10 tRNA-Cys
    1392. Escherichia coli O104:H4 str. E92/11 tRNA-Cys
    1393. Escherichia coli O104:H4 str. Ec11-4984 tRNA-Cys
    1394. Escherichia coli O104:H4 str. Ec11-4986 tRNA-Cys
    1395. Escherichia coli O104:H4 str. Ec11-4987 tRNA-Cys
    1396. Escherichia coli O104:H4 str. Ec11-4988 tRNA-Cys
    1397. Escherichia coli O104:H4 str. Ec11-5603 tRNA-Cys
    1398. Escherichia coli O104:H4 str. Ec11-5604 tRNA-Cys
    1399. Escherichia coli O104:H4 str. Ec11-6006 tRNA-Cys
    1400. Escherichia coli O104:H4 str. Ec11-9450 tRNA-Cys
    1401. Escherichia coli O104:H4 str. Ec11-9941 tRNA-Cys
    1402. Escherichia coli O104:H4 str. Ec11-9990 tRNA-Cys
    1403. Escherichia coli O104:H4 str. Ec12-0465 tRNA-Cys
    1404. Escherichia coli O104:H4 str. Ec12-0466 tRNA-Cys
    1405. Escherichia coli O104:H4 str. LB226692 tRNA-Cys
    1406. Escherichia coli O104:H4 tRNA-Cys
    1407. Escherichia coli O105 tRNA-Cys
    1408. Escherichia coli O108:H9 tRNA-Cys
    1409. Escherichia coli O109 tRNA-Cys
    1410. Escherichia coli O10:H32 tRNA-Cys
    1411. Escherichia coli O10:K5(L):H4 str. ATCC 23506 tRNA-Cys-GCA
    1412. Escherichia coli O111:H11 str. CFSAN001630 tRNA-Cys
    1413. Escherichia coli O111:H11 str. CVM9455 tRNA-Cys
    1414. Escherichia coli O111:H11 str. CVM9534 tRNA-Cys
    1415. Escherichia coli O111:H11 str. CVM9545 tRNA-Cys
    1416. Escherichia coli O111:H11 str. CVM9553 tRNA-Cys
    1417. Escherichia coli O111:H8 str. 2009C-4126 tRNA-Cys
    1418. Escherichia coli O111:H8 str. 2009EL-2169 tRNA-Cys
    1419. Escherichia coli O111:H8 str. 2011C-3453 tRNA-Cys
    1420. Escherichia coli O111:H8 str. CFSAN001632 tRNA-Cys
    1421. Escherichia coli O111:H8 str. CVM9570 tRNA-Cys
    1422. Escherichia coli O111:H8 str. CVM9574 tRNA-Cys
    1423. Escherichia coli O111:H8 str. CVM9602 tRNA-Cys
    1424. Escherichia coli O111:H8 str. CVM9634 tRNA-Cys
    1425. Escherichia coli O111:H8 str. F6627 tRNA-Cys
    1426. Escherichia coli O111:H8 tRNA-Cys
    1427. Escherichia coli O111:H- str. 11128 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1428. Escherichia coli O111:H- tRNA-Cys (GCA)
    1429. Escherichia coli O111:NM str. 01-3076 tRNA-Cys
    1430. Escherichia coli O111:NM str. 03-3484 tRNA-Cys
    1431. Escherichia coli O111:NM str. 04-3211 tRNA-Cys
    1432. Escherichia coli O111:NM str. 08-4487 tRNA-Cys
    1433. Escherichia coli O111:NM str. 2009C-4006 tRNA-Cys
    1434. Escherichia coli O111:NM str. 2009C-4052 tRNA-Cys
    1435. Escherichia coli O111:NM str. 2010C-3053 tRNA-Cys
    1436. Escherichia coli O111:NM str. 2010C-3977 tRNA-Cys
    1437. Escherichia coli O111:NM str. 2010C-4086 tRNA-Cys
    1438. Escherichia coli O111:NM str. 2010C-4221 tRNA-Cys
    1439. Escherichia coli O111:NM str. 2010C-4592 tRNA-Cys
    1440. Escherichia coli O111:NM str. 2010C-4622 tRNA-Cys
    1441. Escherichia coli O111:NM str. 2010C-4715 tRNA-Cys
    1442. Escherichia coli O111:NM str. 2010C-4735 tRNA-Cys
    1443. Escherichia coli O111:NM str. 2010C-4746 tRNA-Cys
    1444. Escherichia coli O111:NM str. 2010C-4799 tRNA-Cys
    1445. Escherichia coli O111:NM str. 2010C-4818 tRNA-Cys
    1446. Escherichia coli O111:NM str. 2011C-3170 tRNA-Cys
    1447. Escherichia coli O111:NM str. 2011C-3362 tRNA-Cys
    1448. Escherichia coli O111:NM str. 2011C-3573 tRNA-Cys
    1449. Escherichia coli O111:NM str. 2011C-3632 tRNA-Cys
    1450. Escherichia coli O111:NM str. 2011C-3679 tRNA-Cys
    1451. Escherichia coli O111:NM str. K6722 tRNA-Cys
    1452. Escherichia coli O111:NM str. K6723 tRNA-Cys
    1453. Escherichia coli O111:NM str. K6728 tRNA-Cys
    1454. Escherichia coli O111:NM str. K6890 tRNA-Cys
    1455. Escherichia coli O111:NM str. K6895 tRNA-Cys
    1456. Escherichia coli O111:NM str. K6897 tRNA-Cys
    1457. Escherichia coli O111:NM str. K6898 tRNA-Cys
    1458. Escherichia coli O111:NM str. K6904 tRNA-Cys
    1459. Escherichia coli O111:NM str. K6908 tRNA-Cys
    1460. Escherichia coli O111:NM str. K6915 tRNA-Cys
    1461. Escherichia coli O111:NM tRNA-Cys
    1462. Escherichia coli O111 str. RM9322 tRNA-Cys
    1463. Escherichia coli O111 tRNA-Cys
    1464. Escherichia coli O112ab:H8 tRNA-Cys
    1465. Escherichia coli O113:H21 str. 07-4224 tRNA-Cys
    1466. Escherichia coli O113:H21 tRNA-Cys
    1467. Escherichia coli O113:H36 tRNA-Cys
    1468. Escherichia coli O113 tRNA-Cys
    1469. Escherichia coli O117 tRNA-Cys
    1470. Escherichia coli O118:H16 str. 06-3256 tRNA-Cys
    1471. Escherichia coli O118:H16 str. 06-3612 tRNA-Cys
    1472. Escherichia coli O118:H16 str. 07-4255 tRNA-Cys
    1473. Escherichia coli O118:H16 str. 08-3651 tRNA-Cys
    1474. Escherichia coli O118:H16 str. 2009C-4446 tRNA-Cys
    1475. Escherichia coli O119:H4 str. 03-3458 tRNA-Cys
    1476. Escherichia coli O119 tRNA-Cys
    1477. Escherichia coli O11:H15 tRNA-Cys
    1478. Escherichia coli O11 tRNA-Cys
    1479. Escherichia coli O120:H10 tRNA-Cys
    1480. Escherichia coli O121:H19 str. 03-3227 tRNA-Cys
    1481. Escherichia coli O121:H19 str. 06-3003 tRNA-Cys
    1482. Escherichia coli O121:H19 str. 06-3822 tRNA-Cys
    1483. Escherichia coli O121:H19 str. 2009C-4050 tRNA-Cys
    1484. Escherichia coli O121:H19 str. 2009C-4659 tRNA-Cys
    1485. Escherichia coli O121:H19 str. 2009C-4750 tRNA-Cys
    1486. Escherichia coli O121:H19 str. 2009EL1302 tRNA-Cys
    1487. Escherichia coli O121:H19 str. 2009EL1412 tRNA-Cys
    1488. Escherichia coli O121:H19 str. 2010C-3609 tRNA-Cys
    1489. Escherichia coli O121:H19 str. 2010C-3794 tRNA-Cys
    1490. Escherichia coli O121:H19 str. 2010C-3840 tRNA-Cys
    1491. Escherichia coli O121:H19 str. 2010C-4254 tRNA-Cys
    1492. Escherichia coli O121:H19 str. 2010C-4732 tRNA-Cys
    1493. Escherichia coli O121:H19 str. 2010C-4824 tRNA-Cys
    1494. Escherichia coli O121:H19 str. 2010C-4966 tRNA-Cys
    1495. Escherichia coli O121:H19 str. 2010C-4989 tRNA-Cys
    1496. Escherichia coli O121:H19 str. 2010EL1058 tRNA-Cys
    1497. Escherichia coli O121:H19 str. 2011C-3072 tRNA-Cys
    1498. Escherichia coli O121:H19 str. 2011C-3108 tRNA-Cys
    1499. Escherichia coli O121:H19 str. 2011C-3216 tRNA-Cys
    1500. Escherichia coli O121:H19 str. 2011C-3500 tRNA-Cys
    1501. Escherichia coli O121:H19 str. 2011C-3537 tRNA-Cys
    1502. Escherichia coli O121:H19 str. 2011C-3609 tRNA-Cys
    1503. Escherichia coli O121:H19 str. F6714 tRNA-Cys
    1504. Escherichia coli O121:H19 str. K5198 tRNA-Cys
    1505. Escherichia coli O121:H19 str. K5269 tRNA-Cys
    1506. Escherichia coli O121:H19 tRNA-Cys
    1507. Escherichia coli O121:H7 str. 2009C-3299 tRNA-Cys
    1508. Escherichia coli O121 str. RM8352 tRNA-Cys
    1509. Escherichia coli O121 tRNA-Cys
    1510. Escherichia coli O123:H11 str. 2009C-3307 tRNA-Cys
    1511. Escherichia coli O126:H45 tRNA-Cys
    1512. Escherichia coli O127:H27 str. C43/90 tRNA-Cys
    1513. Escherichia coli O127:H6 str. E2348/69 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1514. Escherichia coli O127:H6 tRNA-Cys
    1515. Escherichia coli O128ac:H12 tRNA-Cys
    1516. Escherichia coli O128:H2 str. 2011C-3317 tRNA-Cys
    1517. Escherichia coli O128:H42 tRNA-Cys
    1518. Escherichia coli O128 tRNA-Cys
    1519. Escherichia coli O132 tRNA-Cys
    1520. Escherichia coli O136:H26 tRNA-Cys
    1521. Escherichia coli O139:H1 tRNA-Cys
    1522. Escherichia coli O139:H28 str. E24377A tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1523. Escherichia coli O13 tRNA-Cys
    1524. Escherichia coli O141:H4 tRNA-Cys
    1525. Escherichia coli O143:H4 tRNA-Cys
    1526. Escherichia coli O144 tRNA-Cys
    1527. Escherichia coli O145:H25 str. 07-3858 tRNA-Cys
    1528. Escherichia coli O145:H25 tRNA-Cys
    1529. Escherichia coli O145:H28 str. 2009C-3292 tRNA-Cys
    1530. Escherichia coli O145:H28 str. 4865/96 tRNA-Cys
    1531. Escherichia coli O145:H28 str. RM12581 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1532. Escherichia coli O145:H28 str. RM12761 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1533. Escherichia coli O145:H28 str. RM13514 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1534. Escherichia coli O145:H28 str. RM13516 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1535. Escherichia coli O145:H28 tRNA-Cys
    1536. Escherichia coli O145:H34 tRNA-Cys
    1537. Escherichia coli O145:NM str. 06-3484 tRNA-Cys
    1538. Escherichia coli O145:NM str. 08-4270 tRNA-Cys
    1539. Escherichia coli O145:NM str. 2010C-3507 tRNA-Cys
    1540. Escherichia coli O145:NM str. 2010C-3508 tRNA-Cys
    1541. Escherichia coli O145:NM str. 2010C-3509 tRNA-Cys
    1542. Escherichia coli O145:NM str. 2010C-3510 tRNA-Cys
    1543. Escherichia coli O145:NM str. 2010C-3511 tRNA-Cys
    1544. Escherichia coli O145:NM str. 2010C-3516 tRNA-Cys
    1545. Escherichia coli O145:NM str. 2010C-3517 tRNA-Cys
    1546. Escherichia coli O145:NM str. 2010C-3518 tRNA-Cys
    1547. Escherichia coli O145:NM str. 2010C-3521 tRNA-Cys
    1548. Escherichia coli O145:NM str. 2010C-3526 tRNA-Cys
    1549. Escherichia coli O145:NM str. 2010C-4557C2 tRNA-Cys
    1550. Escherichia coli O145:NM tRNA-Cys
    1551. Escherichia coli O145 str. RM9872 tRNA-Cys
    1552. Escherichia coli O145 tRNA-Cys
    1553. Escherichia coli O146:H21 str. 2010C-3325 tRNA-Cys
    1554. Escherichia coli O146 tRNA-Cys
    1555. Escherichia coli O14 tRNA-Cys
    1556. Escherichia coli O150:H6 tRNA-Cys
    1557. Escherichia coli O151:H8 tRNA-Cys
    1558. Escherichia coli O152:H23 tRNA-Cys
    1559. Escherichia coli O153:H2 str. 2010C-5034 tRNA-Cys
    1560. Escherichia coli O153 tRNA-Cys
    1561. Escherichia coli O156:H25 str. 2011C-3602 tRNA-Cys
    1562. Escherichia coli O157:H16 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1563. Escherichia coli O157:H43 str. T22 tRNA-Cys
    1564. Escherichia coli O157:H43 tRNA-Cys
    1565. Escherichia coli O157:H7 str. 06-3745 tRNA-Cys
    1566. Escherichia coli O157:H7 str. 06-4039 tRNA-Cys
    1567. Escherichia coli O157:H7 str. 07-3091 tRNA-Cys
    1568. Escherichia coli O157:H7 str. 07-3391 tRNA-Cys
    1569. Escherichia coli O157:H7 str. 08-3037 tRNA-Cys
    1570. Escherichia coli O157:H7 str. 08-3527 tRNA-Cys
    1571. Escherichia coli O157:H7 str. 08-4169 tRNA-Cys
    1572. Escherichia coli O157:H7 str. 08-4529 tRNA-Cys
    1573. Escherichia coli O157:H7 str. 2009C-4258 tRNA-Cys
    1574. Escherichia coli O157:H7 str. 2009EL1449 tRNA-Cys
    1575. Escherichia coli O157:H7 str. 2009EL1705 tRNA-Cys
    1576. Escherichia coli O157:H7 str. 2009EL1913 tRNA-Cys
    1577. Escherichia coli O157:H7 str. 2009EL2109 tRNA-Cys
    1578. Escherichia coli O157:H7 str. 2010C-4979C1 tRNA-Cys
    1579. Escherichia coli O157:H7 str. 2011EL-1107 tRNA-Cys
    1580. Escherichia coli O157:H7 str. 2011EL-2090 tRNA-Cys
    1581. Escherichia coli O157:H7 str. 2011EL-2091 tRNA-Cys
    1582. Escherichia coli O157:H7 str. 2011EL-2092 tRNA-Cys
    1583. Escherichia coli O157:H7 str. 2011EL-2093 tRNA-Cys
    1584. Escherichia coli O157:H7 str. 2011EL-2094 tRNA-Cys
    1585. Escherichia coli O157:H7 str. 2011EL-2096 tRNA-Cys
    1586. Escherichia coli O157:H7 str. 2011EL-2097 tRNA-Cys
    1587. Escherichia coli O157:H7 str. 2011EL-2098 tRNA-Cys
    1588. Escherichia coli O157:H7 str. 2011EL-2099 tRNA-Cys
    1589. Escherichia coli O157:H7 str. 2011EL-2101 tRNA-Cys
    1590. Escherichia coli O157:H7 str. 2011EL-2103 tRNA-Cys
    1591. Escherichia coli O157:H7 str. 2011EL-2104 tRNA-Cys
    1592. Escherichia coli O157:H7 str. 2011EL-2105 tRNA-Cys
    1593. Escherichia coli O157:H7 str. 2011EL-2106 tRNA-Cys
    1594. Escherichia coli O157:H7 str. 2011EL-2107 tRNA-Cys
    1595. Escherichia coli O157:H7 str. 2011EL-2108 tRNA-Cys
    1596. Escherichia coli O157:H7 str. 2011EL-2109 tRNA-Cys
    1597. Escherichia coli O157:H7 str. 2011EL-2111 tRNA-Cys
    1598. Escherichia coli O157:H7 str. 2011EL-2112 tRNA-Cys
    1599. Escherichia coli O157:H7 str. 2011EL-2113 tRNA-Cys
    1600. Escherichia coli O157:H7 str. 2011EL-2114 tRNA-Cys
    1601. Escherichia coli O157:H7 str. 2011EL-2286 tRNA-Cys
    1602. Escherichia coli O157:H7 str. 2011EL-2287 tRNA-Cys
    1603. Escherichia coli O157:H7 str. 2011EL-2288 tRNA-Cys
    1604. Escherichia coli O157:H7 str. 2011EL-2289 tRNA-Cys
    1605. Escherichia coli O157:H7 str. 2011EL-2290 tRNA-Cys
    1606. Escherichia coli O157:H7 str. 2011EL-2312 tRNA-Cys
    1607. Escherichia coli O157:H7 str. 2011EL-2313 tRNA-Cys
    1608. Escherichia coli O157:H7 str. EC10 tRNA-Cys
    1609. Escherichia coli O157:H7 str. EC1825 tRNA-Cys
    1610. Escherichia coli O157:H7 str. EC4042 tRNA-Cys
    1611. Escherichia coli O157:H7 str. EC4045 tRNA-Cys
    1612. Escherichia coli O157:H7 str. EC4076 tRNA-Cys
    1613. Escherichia coli O157:H7 str. EC4113 tRNA-Cys
    1614. Escherichia coli O157:H7 str. EC4115 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1615. Escherichia coli O157:H7 str. EC4206 tRNA-Cys
    1616. Escherichia coli O157:H7 str. EC4401 tRNA-Cys
    1617. Escherichia coli O157:H7 str. EC4486 tRNA-Cys
    1618. Escherichia coli O157:H7 str. EC4501 tRNA-Cys
    1619. Escherichia coli O157:H7 str. EDL933 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1620. Escherichia coli O157:H7 str. F6142 tRNA-Cys
    1621. Escherichia coli O157:H7 str. F6749 tRNA-Cys
    1622. Escherichia coli O157:H7 str. F6750 tRNA-Cys
    1623. Escherichia coli O157:H7 str. F6751 tRNA-Cys
    1624. Escherichia coli O157:H7 str. F7350 tRNA-Cys
    1625. Escherichia coli O157:H7 str. F7377 tRNA-Cys
    1626. Escherichia coli O157:H7 str. F7384 tRNA-Cys
    1627. Escherichia coli O157:H7 str. F7410 tRNA-Cys
    1628. Escherichia coli O157:H7 str. F8092B tRNA-Cys
    1629. Escherichia coli O157:H7 str. G5101 tRNA-Cys
    1630. Escherichia coli O157:H7 str. G5303 tRNA-Cys
    1631. Escherichia coli O157:H7 str. H2495 tRNA-Cys
    1632. Escherichia coli O157:H7 str. H2498 tRNA-Cys
    1633. Escherichia coli O157:H7 str. K1420 tRNA-Cys
    1634. Escherichia coli O157:H7 str. K1793 tRNA-Cys
    1635. Escherichia coli O157:H7 str. K1795 tRNA-Cys
    1636. Escherichia coli O157:H7 str. K1796 tRNA-Cys
    1637. Escherichia coli O157:H7 str. K1845 tRNA-Cys
    1638. Escherichia coli O157:H7 str. K1921 tRNA-Cys
    1639. Escherichia coli O157:H7 str. K1927 tRNA-Cys
    1640. Escherichia coli O157:H7 str. K2188 tRNA-Cys
    1641. Escherichia coli O157:H7 str. K2191 tRNA-Cys
    1642. Escherichia coli O157:H7 str. K2192 tRNA-Cys
    1643. Escherichia coli O157:H7 str. K2324 tRNA-Cys
    1644. Escherichia coli O157:H7 str. K2581 tRNA-Cys
    1645. Escherichia coli O157:H7 str. K2622 tRNA-Cys
    1646. Escherichia coli O157:H7 str. K2845 tRNA-Cys
    1647. Escherichia coli O157:H7 str. K2854 tRNA-Cys
    1648. Escherichia coli O157:H7 str. K4396 tRNA-Cys
    1649. Escherichia coli O157:H7 str. K4405 tRNA-Cys
    1650. Escherichia coli O157:H7 str. K4406 tRNA-Cys
    1651. Escherichia coli O157:H7 str. K4527 tRNA-Cys
    1652. Escherichia coli O157:H7 str. K5418 tRNA-Cys
    1653. Escherichia coli O157:H7 str. K5448 tRNA-Cys
    1654. Escherichia coli O157:H7 str. K5449 tRNA-Cys
    1655. Escherichia coli O157:H7 str. K5453 tRNA-Cys
    1656. Escherichia coli O157:H7 str. K5460 tRNA-Cys
    1657. Escherichia coli O157:H7 str. K5467 tRNA-Cys
    1658. Escherichia coli O157:H7 str. K5602 tRNA-Cys
    1659. Escherichia coli O157:H7 str. K5607 tRNA-Cys
    1660. Escherichia coli O157:H7 str. K5609 tRNA-Cys
    1661. Escherichia coli O157:H7 str. K5806 tRNA-Cys
    1662. Escherichia coli O157:H7 str. K5852 tRNA-Cys
    1663. Escherichia coli O157:H7 str. K6590 tRNA-Cys
    1664. Escherichia coli O157:H7 str. K6676 tRNA-Cys
    1665. Escherichia coli O157:H7 str. K6687 tRNA-Cys
    1666. Escherichia coli O157:H7 str. K7140 tRNA-Cys
    1667. Escherichia coli O157:H7 str. LSU-61 tRNA-Cys
    1668. Escherichia coli O157:H7 str. Sakai tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1669. Escherichia coli O157:H7 str. SS17 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1670. Escherichia coli O157:H7 str. SS52 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1671. Escherichia coli O157:H7 str. TW14313 tRNA-Cys
    1672. Escherichia coli O157:H7 str. TW14359 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1673. Escherichia coli O157:H7 str. TW14588 tRNA-Cys
    1674. Escherichia coli O157:H7 tRNA-Cys
    1675. Escherichia coli O157:H- str. 493-89 tRNA-Cys
    1676. Escherichia coli O157:H- str. H 2687 tRNA-Cys
    1677. Escherichia coli O157:H- tRNA-Cys
    1678. Escherichia coli O157:NM str. 08-4540 tRNA-Cys
    1679. Escherichia coli O157:NM tRNA-Cys
    1680. Escherichia coli O157: str. 2010EL-2044 tRNA-Cys
    1681. Escherichia coli O157: str. 2010EL-2045 tRNA-Cys
    1682. Escherichia coli O157 tRNA-Cys
    1683. Escherichia coli O158:H23 tRNA-Cys
    1684. Escherichia coli O159:H19 tRNA-Cys
    1685. Escherichia coli O15:H12 tRNA-Cys
    1686. Escherichia coli O15:H18 str. K1516 tRNA-Cys
    1687. Escherichia coli O15:H21 tRNA-Cys
    1688. Escherichia coli O163 tRNA-Cys
    1689. Escherichia coli O165:H25 str. 2010C-4874 tRNA-Cys
    1690. Escherichia coli O166:H49 tRNA-Cys
    1691. Escherichia coli O167:H26 tRNA-Cys
    1692. Escherichia coli O167:H9 tRNA-Cys
    1693. Escherichia coli O169:H41 str. F9792 tRNA-Cys
    1694. Escherichia coli O16:H48 tRNA-Cys
    1695. Escherichia coli O170:H18 tRNA-Cys
    1696. Escherichia coli O174:H21 str. 03-3269 tRNA-Cys
    1697. Escherichia coli O174:H7 tRNA-Cys
    1698. Escherichia coli O174:H8 str. 04-3038 tRNA-Cys
    1699. Escherichia coli O176:H45 tRNA-Cys
    1700. Escherichia coli O177:NM str. 2010C-4558 tRNA-Cys
    1701. Escherichia coli O177 tRNA-Cys
    1702. Escherichia coli O18ac:H14 tRNA-Cys
    1703. Escherichia coli O18:H1 tRNA-Cys
    1704. Escherichia coli O18:H7 tRNA-Cys
    1705. Escherichia coli O19:H42 tRNA-Cys
    1706. Escherichia coli O19:H7 tRNA-Cys
    1707. Escherichia coli O19 tRNA-Cys
    1708. Escherichia coli O1:H42 tRNA-Cys
    1709. Escherichia coli O1:H7 tRNA-Cys
    1710. Escherichia coli O1:HNT tRNA-Cys
    1711. Escherichia coli O20:H12 tRNA-Cys
    1712. Escherichia coli O22:H8 tRNA-Cys
    1713. Escherichia coli O24 tRNA-Cys
    1714. Escherichia coli O25b:H4-ST131 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1715. Escherichia coli O25b:H4 tRNA-Cys
    1716. Escherichia coli O25:H4 tRNA-Cys
    1717. Escherichia coli O25:NM str. E2539C1 tRNA-Cys
    1718. Escherichia coli O26:H11 str. 03-3500 tRNA-Cys
    1719. Escherichia coli O26:H11 str. 05-3646 tRNA-Cys
    1720. Escherichia coli O26:H11 str. 06-3464 tRNA-Cys
    1721. Escherichia coli O26:H11 str. 11368 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1722. Escherichia coli O26:H11 str. 2009C-3612 tRNA-Cys
    1723. Escherichia coli O26:H11 str. 2009C-3689 tRNA-Cys
    1724. Escherichia coli O26:H11 str. 2009C-3996 tRNA-Cys
    1725. Escherichia coli O26:H11 str. 2009C-4760 tRNA-Cys
    1726. Escherichia coli O26:H11 str. 2009C-4826 tRNA-Cys
    1727. Escherichia coli O26:H11 str. 2010C-3051 tRNA-Cys
    1728. Escherichia coli O26:H11 str. 2010C-3472 tRNA-Cys
    1729. Escherichia coli O26:H11 str. 2010C-3871 tRNA-Cys
    1730. Escherichia coli O26:H11 str. 2010C-3902 tRNA-Cys
    1731. Escherichia coli O26:H11 str. 2010C-4244 tRNA-Cys
    1732. Escherichia coli O26:H11 str. 2010C-4430 tRNA-Cys
    1733. Escherichia coli O26:H11 str. 2010C-4819 tRNA-Cys
    1734. Escherichia coli O26:H11 str. 2010C-4834 tRNA-Cys
    1735. Escherichia coli O26:H11 str. 2010C-5028 tRNA-Cys
    1736. Escherichia coli O26:H11 str. 2010EL-1699 tRNA-Cys
    1737. Escherichia coli O26:H11 str. 2011C-3270 tRNA-Cys
    1738. Escherichia coli O26:H11 str. 2011C-3274 tRNA-Cys
    1739. Escherichia coli O26:H11 str. 2011C-3282 tRNA-Cys
    1740. Escherichia coli O26:H11 str. 2011C-3387 tRNA-Cys
    1741. Escherichia coli O26:H11 str. 2011C-3506 tRNA-Cys
    1742. Escherichia coli O26:H11 str. 2011C-3655 tRNA-Cys
    1743. Escherichia coli O26:H11 str. CFSAN001629 tRNA-Cys
    1744. Escherichia coli O26:H11 str. CVM10021 tRNA-Cys
    1745. Escherichia coli O26:H11 str. CVM10026 tRNA-Cys
    1746. Escherichia coli O26:H11 str. CVM10030 tRNA-Cys
    1747. Escherichia coli O26:H11 str. CVM10224 tRNA-Cys
    1748. Escherichia coli O26:H11 str. CVM9942 tRNA-Cys
    1749. Escherichia coli O26:H11 str. CVM9952 tRNA-Cys
    1750. Escherichia coli O26:H11 tRNA-Cys
    1751. Escherichia coli O26:H1 str. 2009C-4747 tRNA-Cys
    1752. Escherichia coli O26:NM str. 2010C-4347 tRNA-Cys
    1753. Escherichia coli O26:NM str. 2010C-4788 tRNA-Cys
    1754. Escherichia coli O26 str. RM10386 tRNA-Cys
    1755. Escherichia coli O26 str. RM8426 tRNA-Cys
    1756. Escherichia coli O26 tRNA-Cys
    1757. Escherichia coli O28ac:NM str. 02-3404 tRNA-Cys
    1758. Escherichia coli O2:H1 tRNA-Cys
    1759. Escherichia coli O2:H32 tRNA-Cys
    1760. Escherichia coli O2:H6 tRNA-Cys
    1761. Escherichia coli O2 tRNA-Cys
    1762. Escherichia coli O32:H37 str. P4 tRNA-Cys
    1763. Escherichia coli O33 tRNA-Cys
    1764. Escherichia coli O36:H5 tRNA-Cys
    1765. Escherichia coli O36 tRNA-Cys
    1766. Escherichia coli O38:H26 tRNA-Cys
    1767. Escherichia coli O39:H21 tRNA-Cys
    1768. Escherichia coli O39:H4 tRNA-Cys
    1769. Escherichia coli O40:H32 tRNA-Cys
    1770. Escherichia coli O43:H14 tRNA-Cys
    1771. Escherichia coli O43 str. RM10042 tRNA-Cys
    1772. Escherichia coli O45:H2 str. 01-3147 tRNA-Cys
    1773. Escherichia coli O45:H2 str. 2009C-3686 tRNA-Cys
    1774. Escherichia coli O45:H2 str. 2009C-4780 tRNA-Cys
    1775. Escherichia coli O45:H2 str. 2010C-3876 tRNA-Cys
    1776. Escherichia coli O45:H2 str. 2010C-4211 tRNA-Cys
    1777. Escherichia coli O45:H2 tRNA-Cys
    1778. Escherichia coli O49:H9 tRNA-Cys
    1779. Escherichia coli O53 tRNA-Cys
    1780. Escherichia coli O55:H7 str. 06-3555 tRNA-Cys
    1781. Escherichia coli O55:H7 str. 3256-97 tRNA-Cys
    1782. Escherichia coli O55:H7 str. CB9615 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1783. Escherichia coli O55:H7 str. RM12579 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1784. Escherichia coli O55:H7 str. TB182A tRNA-Cys
    1785. Escherichia coli O55:H7 str. USDA 5905 tRNA-Cys
    1786. Escherichia coli O55:H7 tRNA-Cys
    1787. Escherichia coli O5:K4(L):H4 str. ATCC 23502 tRNA-Cys-GCA
    1788. Escherichia coli O5 tRNA-Cys
    1789. Escherichia coli O68:H12 tRNA-Cys
    1790. Escherichia coli O69:H11 str. 06-3325 tRNA-Cys
    1791. Escherichia coli O69:H11 str. 07-3763 tRNA-Cys
    1792. Escherichia coli O69:H11 str. 07-4281 tRNA-Cys
    1793. Escherichia coli O69:H11 str. 08-4661 tRNA-Cys
    1794. Escherichia coli O69:H11 str. 2009C-3601 tRNA-Cys
    1795. Escherichia coli O6:H16:CFA/II str. B2C tRNA-Cys
    1796. Escherichia coli O6:H16 str. 99-3165 tRNA-Cys
    1797. Escherichia coli O6:H16 str. F5656C1 tRNA-Cys
    1798. Escherichia coli O6:H34 tRNA-Cys
    1799. Escherichia coli O6 tRNA-Cys
    1800. Escherichia coli O70:H25 tRNA-Cys
    1801. Escherichia coli O74:H8 tRNA-Cys
    1802. Escherichia coli O74 tRNA-Cys
    1803. Escherichia coli O78:H12 str. 00-3279 tRNA-Cys
    1804. Escherichia coli O78:H42 tRNA-Cys
    1805. Escherichia coli O79:H7 str. 06-3501 tRNA-Cys
    1806. Escherichia coli O7:H4 tRNA-Cys
    1807. Escherichia coli O7:K1 str. CE10 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1808. Escherichia coli O80:H26 tRNA-Cys
    1809. Escherichia coli O80:H45 tRNA-Cys
    1810. Escherichia coli O81:NM str. 02-3012 tRNA-Cys
    1811. Escherichia coli O83:H1 str. NRG 857C tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1812. Escherichia coli O83:H31 tRNA-Cys
    1813. Escherichia coli O83 tRNA-Cys
    1814. Escherichia coli O84:H7 tRNA-Cys
    1815. Escherichia coli O85:H1 tRNA-Cys
    1816. Escherichia coli O86:H34 str. 99-3124 tRNA-Cys
    1817. Escherichia coli O86:H8 tRNA-Cys
    1818. Escherichia coli O88:H1 tRNA-Cys
    1819. Escherichia coli O88:H4 tRNA-Cys
    1820. Escherichia coli O89m:H10 tRNA-Cys
    1821. Escherichia coli O89m:H9 tRNA-Cys
    1822. Escherichia coli O8:H19 tRNA-Cys
    1823. Escherichia coli O8:H28 tRNA-Cys
    1824. Escherichia coli O8:H31 tRNA-Cys
    1825. Escherichia coli O8:H36 tRNA-Cys
    1826. Escherichia coli O8:H49 tRNA-Cys
    1827. Escherichia coli O8:H8 tRNA-Cys
    1828. Escherichia coli O8:H9 tRNA-Cys
    1829. Escherichia coli O8 tRNA-Cys
    1830. Escherichia coli O91:H14 str. 06-3691 tRNA-Cys
    1831. Escherichia coli O91:H14 str. 2009C-3227 tRNA-Cys
    1832. Escherichia coli O91:H21 str. 2009C-3740 tRNA-Cys
    1833. Escherichia coli O91:H21 str. 2009C-4646 tRNA-Cys
    1834. Escherichia coli O91:H21 tRNA-Cys
    1835. Escherichia coli O91:H28 tRNA-Cys
    1836. Escherichia coli O91:NM str. 2009C-3745 tRNA-Cys
    1837. Escherichia coli O91 str. RM7190 tRNA-Cys
    1838. Escherichia coli O91 tRNA-Cys
    1839. Escherichia coli O96 tRNA-Cys
    1840. Escherichia coli O99:H27 tRNA-Cys
    1841. Escherichia coli O9:H10 tRNA-Cys
    1842. Escherichia coli OK1180 tRNA-Cys
    1843. Escherichia coli OK1357 tRNA-Cys
    1844. Escherichia coli ONT:H33 str. C48/93 tRNA-Cys
    1845. Escherichia coli OP50 tRNA-Cys
    1846. Escherichia coli OX01:H8 tRNA-Cys
    1847. Escherichia coli OX38:H47 tRNA-Cys
    1848. Escherichia coli P0298942.10 tRNA-Cys
    1849. Escherichia coli P0298942.11 tRNA-Cys
    1850. Escherichia coli P0298942.12 tRNA-Cys
    1851. Escherichia coli P0298942.14 tRNA-Cys
    1852. Escherichia coli P0298942.15 tRNA-Cys
    1853. Escherichia coli P0298942.1 tRNA-Cys
    1854. Escherichia coli P0298942.2 tRNA-Cys
    1855. Escherichia coli P0298942.3 tRNA-Cys
    1856. Escherichia coli P0298942.4 tRNA-Cys
    1857. Escherichia coli P0298942.6 tRNA-Cys
    1858. Escherichia coli P0298942.7 tRNA-Cys
    1859. Escherichia coli P0298942.8 tRNA-Cys
    1860. Escherichia coli P0298942.9 tRNA-Cys
    1861. Escherichia coli P0299438.10 tRNA-Cys
    1862. Escherichia coli P0299438.11 tRNA-Cys
    1863. Escherichia coli P0299438.2 tRNA-Cys
    1864. Escherichia coli P0299438.3 tRNA-Cys
    1865. Escherichia coli P0299438.4 tRNA-Cys
    1866. Escherichia coli P0299438.5 tRNA-Cys
    1867. Escherichia coli P0299438.6 tRNA-Cys
    1868. Escherichia coli P0299438.7 tRNA-Cys
    1869. Escherichia coli P0299438.8 tRNA-Cys
    1870. Escherichia coli P0299438.9 tRNA-Cys
    1871. Escherichia coli P0299483.1 tRNA-Cys
    1872. Escherichia coli P0299483.2 tRNA-Cys
    1873. Escherichia coli P0299483.3 tRNA-Cys
    1874. Escherichia coli P02997067.6 tRNA-Cys
    1875. Escherichia coli P0299917.10 tRNA-Cys
    1876. Escherichia coli P0299917.1 tRNA-Cys
    1877. Escherichia coli P0299917.2 tRNA-Cys
    1878. Escherichia coli P0299917.3 tRNA-Cys
    1879. Escherichia coli P0299917.4 tRNA-Cys
    1880. Escherichia coli P0299917.5 tRNA-Cys
    1881. Escherichia coli P0299917.6 tRNA-Cys
    1882. Escherichia coli P0299917.7 tRNA-Cys
    1883. Escherichia coli P0299917.8 tRNA-Cys
    1884. Escherichia coli P0299917.9 tRNA-Cys
    1885. Escherichia coli P0301867.11 tRNA-Cys
    1886. Escherichia coli P0301867.13 tRNA-Cys
    1887. Escherichia coli P0301867.1 tRNA-Cys
    1888. Escherichia coli P0301867.2 tRNA-Cys
    1889. Escherichia coli P0301867.3 tRNA-Cys
    1890. Escherichia coli P0301867.4 tRNA-Cys
    1891. Escherichia coli P0301867.5 tRNA-Cys
    1892. Escherichia coli P0301867.7 tRNA-Cys
    1893. Escherichia coli P0301867.8 tRNA-Cys
    1894. Escherichia coli P0301904.3 tRNA-Cys
    1895. Escherichia coli P0302293.10 tRNA-Cys
    1896. Escherichia coli P0302293.2 tRNA-Cys
    1897. Escherichia coli P0302293.3 tRNA-Cys
    1898. Escherichia coli P0302293.4 tRNA-Cys
    1899. Escherichia coli P0302293.6 tRNA-Cys
    1900. Escherichia coli P0302293.7 tRNA-Cys
    1901. Escherichia coli P0302293.8 tRNA-Cys
    1902. Escherichia coli P0302293.9 tRNA-Cys
    1903. Escherichia coli P0302308.10 tRNA-Cys
    1904. Escherichia coli P0302308.11 tRNA-Cys
    1905. Escherichia coli P0302308.12 tRNA-Cys
    1906. Escherichia coli P0302308.13 tRNA-Cys
    1907. Escherichia coli P0302308.14 tRNA-Cys
    1908. Escherichia coli P0302308.1 tRNA-Cys
    1909. Escherichia coli P0302308.2 tRNA-Cys
    1910. Escherichia coli P0302308.3 tRNA-Cys
    1911. Escherichia coli P0302308.4 tRNA-Cys
    1912. Escherichia coli P0302308.5 tRNA-Cys
    1913. Escherichia coli P0304777.10 tRNA-Cys
    1914. Escherichia coli P0304777.11 tRNA-Cys
    1915. Escherichia coli P0304777.12 tRNA-Cys
    1916. Escherichia coli P0304777.13 tRNA-Cys
    1917. Escherichia coli P0304777.14 tRNA-Cys
    1918. Escherichia coli P0304777.15 tRNA-Cys
    1919. Escherichia coli P0304777.1 tRNA-Cys
    1920. Escherichia coli P0304777.2 tRNA-Cys
    1921. Escherichia coli P0304777.3 tRNA-Cys
    1922. Escherichia coli P0304777.4 tRNA-Cys
    1923. Escherichia coli P0304777.5 tRNA-Cys
    1924. Escherichia coli P0304777.7 tRNA-Cys
    1925. Escherichia coli P0304777.8 tRNA-Cys
    1926. Escherichia coli P0304777.9 tRNA-Cys
    1927. Escherichia coli P0304799.3 tRNA-Cys
    1928. Escherichia coli P0304816.10 tRNA-Cys
    1929. Escherichia coli P0304816.11 tRNA-Cys
    1930. Escherichia coli P0304816.12 tRNA-Cys
    1931. Escherichia coli P0304816.13 tRNA-Cys
    1932. Escherichia coli P0304816.14 tRNA-Cys
    1933. Escherichia coli P0304816.15 tRNA-Cys
    1934. Escherichia coli P0304816.1 tRNA-Cys
    1935. Escherichia coli P0304816.2 tRNA-Cys
    1936. Escherichia coli P0304816.3 tRNA-Cys
    1937. Escherichia coli P0304816.4 tRNA-Cys
    1938. Escherichia coli P0304816.5 tRNA-Cys
    1939. Escherichia coli P0304816.6 tRNA-Cys
    1940. Escherichia coli P0304816.7 tRNA-Cys
    1941. Escherichia coli P0304816.8 tRNA-Cys
    1942. Escherichia coli P0304816.9 tRNA-Cys
    1943. Escherichia coli P0305260.10 tRNA-Cys
    1944. Escherichia coli P0305260.11 tRNA-Cys
    1945. Escherichia coli P0305260.12 tRNA-Cys
    1946. Escherichia coli P0305260.13 tRNA-Cys
    1947. Escherichia coli P0305260.15 tRNA-Cys
    1948. Escherichia coli P0305260.1 tRNA-Cys
    1949. Escherichia coli P0305260.2 tRNA-Cys
    1950. Escherichia coli P0305260.3 tRNA-Cys
    1951. Escherichia coli P0305260.4 tRNA-Cys
    1952. Escherichia coli P0305260.5 tRNA-Cys
    1953. Escherichia coli P0305260.6 tRNA-Cys
    1954. Escherichia coli P0305260.7 tRNA-Cys
    1955. Escherichia coli P0305260.8 tRNA-Cys
    1956. Escherichia coli P0305260.9 tRNA-Cys
    1957. Escherichia coli p0305293.10 tRNA-Cys
    1958. Escherichia coli p0305293.11 tRNA-Cys
    1959. Escherichia coli p0305293.12 tRNA-Cys
    1960. Escherichia coli p0305293.13 tRNA-Cys
    1961. Escherichia coli p0305293.14 tRNA-Cys
    1962. Escherichia coli p0305293.15 tRNA-Cys
    1963. Escherichia coli p0305293.1 tRNA-Cys
    1964. Escherichia coli p0305293.2 tRNA-Cys
    1965. Escherichia coli p0305293.3 tRNA-Cys
    1966. Escherichia coli p0305293.4 tRNA-Cys
    1967. Escherichia coli p0305293.5 tRNA-Cys
    1968. Escherichia coli p0305293.6 tRNA-Cys
    1969. Escherichia coli p0305293.7 tRNA-Cys
    1970. Escherichia coli p0305293.8 tRNA-Cys
    1971. Escherichia coli p0305293.9 tRNA-Cys
    1972. Escherichia coli P12b tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    1973. Escherichia coli P4-96 tRNA-Cys
    1974. Escherichia coli P4-NR tRNA-Cys
    1975. Escherichia coli PA10 tRNA-Cys
    1976. Escherichia coli PA11 tRNA-Cys
    1977. Escherichia coli PA13 tRNA-Cys
    1978. Escherichia coli PA14 tRNA-Cys
    1979. Escherichia coli PA15 tRNA-Cys
    1980. Escherichia coli PA19 tRNA-Cys
    1981. Escherichia coli PA22 tRNA-Cys
    1982. Escherichia coli PA23 tRNA-Cys
    1983. Escherichia coli PA24 tRNA-Cys
    1984. Escherichia coli PA25 tRNA-Cys
    1985. Escherichia coli PA28 tRNA-Cys
    1986. Escherichia coli PA2 tRNA-Cys
    1987. Escherichia coli PA31 tRNA-Cys
    1988. Escherichia coli PA32 tRNA-Cys
    1989. Escherichia coli PA33 tRNA-Cys
    1990. Escherichia coli PA34 tRNA-Cys
    1991. Escherichia coli PA35 tRNA-Cys
    1992. Escherichia coli PA38 tRNA-Cys
    1993. Escherichia coli PA39 tRNA-Cys
    1994. Escherichia coli PA3 tRNA-Cys
    1995. Escherichia coli PA40 tRNA-Cys
    1996. Escherichia coli PA41 tRNA-Cys
    1997. Escherichia coli PA42 tRNA-Cys
    1998. Escherichia coli PA45 tRNA-Cys
    1999. Escherichia coli PA47 tRNA-Cys
    2000. Escherichia coli PA48 tRNA-Cys
    2001. Escherichia coli PA49 tRNA-Cys
    2002. Escherichia coli PA4 tRNA-Cys
    2003. Escherichia coli PA5 tRNA-Cys
    2004. Escherichia coli PA7 tRNA-Cys
    2005. Escherichia coli PA8 tRNA-Cys
    2006. Escherichia coli PA9 tRNA-Cys
    2007. Escherichia coli PCN061 tRNA-Cys
    2008. Escherichia coli PMV-1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2009. Escherichia coli R424 tRNA-Cys
    2010. Escherichia coli R527 tRNA-Cys
    2011. Escherichia coli RN587/1 tRNA-Cys
    2012. Escherichia coli RS218 tRNA-Cys
    2013. Escherichia coli S17 tRNA-Cys
    2014. Escherichia coli S88 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2015. Escherichia coli SCI-07 tRNA-Cys
    2016. Escherichia coli SE11 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2017. Escherichia coli SE15 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2018. Escherichia coli SEPT362 tRNA-Cys
    2019. Escherichia coli SHECO001 tRNA-Cys
    2020. Escherichia coli SHECO002 tRNA-Cys
    2021. Escherichia coli SHECO003 tRNA-Cys
    2022. Escherichia coli SMS-3-5 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2023. Escherichia coli STEC_7v tRNA-Cys
    2024. Escherichia coli STEC_94C tRNA-Cys
    2025. Escherichia coli O91:H21 str. B2F1 tRNA-Cys
    2026. Escherichia coli STEC_C165-02 tRNA-Cys
    2027. Escherichia coli STEC_DG131-3 tRNA-Cys
    2028. Escherichia coli STEC_EH250 tRNA-Cys
    2029. Escherichia coli STEC_MHI813 tRNA-Cys
    2030. Escherichia coli STEC_O31 tRNA-Cys
    2031. Escherichia coli STEC_S1191 tRNA-Cys
    2032. Escherichia coli str. 'clone D i14' tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2033. Escherichia coli str. 'clone D i2' tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2034. Escherichia coli str. K-12 substr. DH10B tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2035. Escherichia coli str. K-12 substr. MC4100 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2036. Escherichia coli str. K-12 substr. MDS42 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2037. Escherichia coli str. K-12 substr. MG1655 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2038. Escherichia coli str. K-12 substr. W3110 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2039. Escherichia coli str. Sanji tRNA-Cys
    2040. Escherichia coli SWW33 tRNA-Cys
    2041. Escherichia coli T1282_01 tRNA-Cys
    2042. Escherichia coli T1840_97 tRNA-Cys
    2043. Escherichia coli T234_00 tRNA-Cys
    2044. Escherichia coli T426 tRNA-Cys
    2045. Escherichia coli T924_01 tRNA-Cys
    2046. Escherichia coli TA007 tRNA-Cys
    2047. Escherichia coli TA008 tRNA-Cys
    2048. Escherichia coli TA014 tRNA-Cys
    2049. Escherichia coli TA054 tRNA-Cys
    2050. Escherichia coli TA124 tRNA-Cys
    2051. Escherichia coli TA143 tRNA-Cys
    2052. Escherichia coli TA144 tRNA-Cys
    2053. Escherichia coli TA206 tRNA-Cys
    2054. Escherichia coli TA249 tRNA-Cys
    2055. Escherichia coli TA255 tRNA-Cys
    2056. Escherichia coli TA271 tRNA-Cys
    2057. Escherichia coli TA280 tRNA-Cys
    2058. Escherichia coli TA447 tRNA-Cys
    2059. Escherichia coli TA464 tRNA-Cys
    2060. Escherichia coli ThroopD tRNA-Cys
    2061. Escherichia coli TT12B tRNA-Cys
    2062. Escherichia coli TW00353 tRNA-Cys
    2063. Escherichia coli TW06591 tRNA-Cys
    2064. Escherichia coli TW07509 tRNA-Cys
    2065. Escherichia coli TW07793 tRNA-Cys
    2066. Escherichia coli TW07945 tRNA-Cys
    2067. Escherichia coli TW09098 tRNA-Cys
    2068. Escherichia coli TW09109 tRNA-Cys
    2069. Escherichia coli TW09195 tRNA-Cys
    2070. Escherichia coli TW10119 tRNA-Cys
    2071. Escherichia coli TW10246 tRNA-Cys
    2072. Escherichia coli TW10509 tRNA-Cys
    2073. Escherichia coli TW11039 tRNA-Cys
    2074. Escherichia coli TW14301 tRNA-Cys
    2075. Escherichia coli TW15901 tRNA-Cys
    2076. Escherichia coli Tx1686 tRNA-Cys
    2077. Escherichia coli TX1999 tRNA-Cys
    2078. Escherichia coli Tx3800 tRNA-Cys
    2079. Escherichia coli UCI 51 tRNA-Cys
    2080. Escherichia coli UCI 52 tRNA-Cys
    2081. Escherichia coli UCI 53 tRNA-Cys
    2082. Escherichia coli UCI 57 tRNA-Cys
    2083. Escherichia coli UCI 58 tRNA-Cys
    2084. Escherichia coli UCI 65 tRNA-Cys
    2085. Escherichia coli UCI 66 tRNA-Cys
    2086. Escherichia coli UM146 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2087. Escherichia coli UMEA 3014-1 tRNA-Cys
    2088. Escherichia coli UMEA 3022-1 tRNA-Cys
    2089. Escherichia coli UMEA 3033-1 tRNA-Cys
    2090. Escherichia coli UMEA 3041-1 tRNA-Cys
    2091. Escherichia coli UMEA 3052-1 tRNA-Cys
    2092. Escherichia coli UMEA 3053-1 tRNA-Cys
    2093. Escherichia coli UMEA 3065-1 tRNA-Cys
    2094. Escherichia coli UMEA 3087-1 tRNA-Cys
    2095. Escherichia coli UMEA 3088-1 tRNA-Cys
    2096. Escherichia coli UMEA 3097-1 tRNA-Cys
    2097. Escherichia coli UMEA 3108-1 tRNA-Cys
    2098. Escherichia coli UMEA 3113-1 tRNA-Cys
    2099. Escherichia coli UMEA 3117-1 tRNA-Cys
    2100. Escherichia coli UMEA 3121-1 tRNA-Cys
    2101. Escherichia coli UMEA 3122-1 tRNA-Cys
    2102. Escherichia coli UMEA 3124-1 tRNA-Cys
    2103. Escherichia coli UMEA 3139-1 tRNA-Cys
    2104. Escherichia coli UMEA 3140-1 tRNA-Cys
    2105. Escherichia coli UMEA 3144-1 tRNA-Cys
    2106. Escherichia coli UMEA 3148-1 tRNA-Cys
    2107. Escherichia coli UMEA 3150-1 tRNA-Cys
    2108. Escherichia coli UMEA 3151-1 tRNA-Cys
    2109. Escherichia coli UMEA 3152-1 tRNA-Cys
    2110. Escherichia coli UMEA 3155-1 tRNA-Cys
    2111. Escherichia coli UMEA 3159-1 tRNA-Cys
    2112. Escherichia coli UMEA 3160-1 tRNA-Cys
    2113. Escherichia coli UMEA 3161-1 tRNA-Cys
    2114. Escherichia coli UMEA 3162-1 tRNA-Cys
    2115. Escherichia coli UMEA 3163-1 tRNA-Cys
    2116. Escherichia coli UMEA 3172-1 tRNA-Cys
    2117. Escherichia coli UMEA 3173-1 tRNA-Cys
    2118. Escherichia coli UMEA 3174-1 tRNA-Cys
    2119. Escherichia coli UMEA 3175-1 tRNA-Cys
    2120. Escherichia coli UMEA 3176-1 tRNA-Cys
    2121. Escherichia coli UMEA 3178-1 tRNA-Cys
    2122. Escherichia coli UMEA 3180-1 tRNA-Cys
    2123. Escherichia coli UMEA 3185-1 tRNA-Cys
    2124. Escherichia coli UMEA 3190-1 tRNA-Cys
    2125. Escherichia coli UMEA 3193-1 tRNA-Cys
    2126. Escherichia coli UMEA 3199-1 tRNA-Cys
    2127. Escherichia coli UMEA 3200-1 tRNA-Cys
    2128. Escherichia coli UMEA 3201-1 tRNA-Cys
    2129. Escherichia coli UMEA 3203-1 tRNA-Cys
    2130. Escherichia coli UMEA 3206-1 tRNA-Cys
    2131. Escherichia coli UMEA 3208-1 tRNA-Cys
    2132. Escherichia coli UMEA 3212-1 tRNA-Cys
    2133. Escherichia coli UMEA 3215-1 tRNA-Cys
    2134. Escherichia coli UMEA 3216-1 tRNA-Cys
    2135. Escherichia coli UMEA 3217-1 tRNA-Cys
    2136. Escherichia coli UMEA 3220-1 tRNA-Cys
    2137. Escherichia coli UMEA 3221-1 tRNA-Cys
    2138. Escherichia coli UMEA 3222-1 tRNA-Cys
    2139. Escherichia coli UMEA 3230-1 tRNA-Cys
    2140. Escherichia coli UMEA 3233-1 tRNA-Cys
    2141. Escherichia coli UMEA 3240-1 tRNA-Cys
    2142. Escherichia coli UMEA 3244-1 tRNA-Cys
    2143. Escherichia coli UMEA 3252-1 tRNA-Cys
    2144. Escherichia coli UMEA 3257-1 tRNA-Cys
    2145. Escherichia coli UMEA 3264-1 tRNA-Cys
    2146. Escherichia coli UMEA 3268-1 tRNA-Cys
    2147. Escherichia coli UMEA 3271-1 tRNA-Cys
    2148. Escherichia coli UMEA 3290-1 tRNA-Cys
    2149. Escherichia coli UMEA 3292-1 tRNA-Cys
    2150. Escherichia coli UMEA 3298-1 tRNA-Cys
    2151. Escherichia coli UMEA 3304-1 tRNA-Cys
    2152. Escherichia coli UMEA 3314-1 tRNA-Cys
    2153. Escherichia coli UMEA 3317-1 tRNA-Cys
    2154. Escherichia coli UMEA 3318-1 tRNA-Cys
    2155. Escherichia coli UMEA 3323-1 tRNA-Cys
    2156. Escherichia coli UMEA 3329-1 tRNA-Cys
    2157. Escherichia coli UMEA 3336-1 tRNA-Cys
    2158. Escherichia coli UMEA 3337-1 tRNA-Cys
    2159. Escherichia coli UMEA 3341-1 tRNA-Cys
    2160. Escherichia coli UMEA 3342-1 tRNA-Cys
    2161. Escherichia coli UMEA 3355-1 tRNA-Cys
    2162. Escherichia coli UMEA 3391-1 tRNA-Cys
    2163. Escherichia coli UMEA 3426-1 tRNA-Cys
    2164. Escherichia coli UMEA 3489-1 tRNA-Cys
    2165. Escherichia coli UMEA 3490-1 tRNA-Cys
    2166. Escherichia coli UMEA 3585-1 tRNA-Cys
    2167. Escherichia coli UMEA 3592-1 tRNA-Cys
    2168. Escherichia coli UMEA 3609-1 tRNA-Cys
    2169. Escherichia coli UMEA 3617-1 tRNA-Cys
    2170. Escherichia coli UMEA 3632-1 tRNA-Cys
    2171. Escherichia coli UMEA 3652-1 tRNA-Cys
    2172. Escherichia coli UMEA 3656-1 tRNA-Cys
    2173. Escherichia coli UMEA 3662-1 tRNA-Cys
    2174. Escherichia coli UMEA 3671-1 tRNA-Cys
    2175. Escherichia coli UMEA 3682-1 tRNA-Cys
    2176. Escherichia coli UMEA 3687-1 tRNA-Cys
    2177. Escherichia coli UMEA 3693-1 tRNA-Cys
    2178. Escherichia coli UMEA 3694-1 tRNA-Cys
    2179. Escherichia coli UMEA 3702-1 tRNA-Cys
    2180. Escherichia coli UMEA 3703-1 tRNA-Cys
    2181. Escherichia coli UMEA 3705-1 tRNA-Cys
    2182. Escherichia coli UMEA 3707-1 tRNA-Cys
    2183. Escherichia coli UMEA 3718-1 tRNA-Cys
    2184. Escherichia coli UMEA 3805-1 tRNA-Cys
    2185. Escherichia coli UMEA 3821-1 tRNA-Cys
    2186. Escherichia coli UMEA 3834-1 tRNA-Cys
    2187. Escherichia coli UMEA 3889-1 tRNA-Cys
    2188. Escherichia coli UMEA 3893-1 tRNA-Cys
    2189. Escherichia coli UMEA 3899-1 tRNA-Cys
    2190. Escherichia coli UMEA 3955-1 tRNA-Cys
    2191. Escherichia coli UMEA 4075-1 tRNA-Cys
    2192. Escherichia coli UMEA 4076-1 tRNA-Cys
    2193. Escherichia coli UMEA 4207-1 tRNA-Cys
    2194. Escherichia coli UMN026 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2195. Escherichia coli UMNF18 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2196. Escherichia coli UMNK88 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2197. Escherichia coli UTI89 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2198. Escherichia coli VL2732 tRNA-Cys
    2199. Escherichia coli VL2874 tRNA-Cys
    2200. Escherichia coli VR50 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2201. Escherichia coli W26 tRNA-Cys
    2202. Escherichia coli W tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2203. Escherichia coli XH001 tRNA-Cys
    2204. Escherichia coli XH140A tRNA-Cys
    2205. Escherichia coli Xuzhou21 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2206. Escherichia fergusonii ATCC 35469 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2207. Escherichia fergusonii B253 tRNA-Cys
    2208. Escherichia fergusonii tRNA-Cys(gca)
    2209. Escherichia marmotae tRNA-Cys(gca)
    2210. Escherichia sp. 0.2392 tRNA-Cys
    2211. Escherichia sp. 11.1596 tRNA-Cys
    2212. Escherichia sp. 11.1597 tRNA-Cys
    2213. Escherichia sp. 11.1600 tRNA-Cys
    2214. Escherichia sp. 1_1_43 tRNA-Cys
    2215. Escherichia sp. 12.2610 tRNA-Cys
    2216. Escherichia sp. 12.2612 tRNA-Cys
    2217. Escherichia sp. 14.0982 tRNA-Cys
    2218. Escherichia sp. 14.0985 tRNA-Cys
    2219. Escherichia sp. 20412-1 tRNA-Cys
    2220. Escherichia sp. 4_1_40B tRNA-Cys
    2221. Escherichia sp. 4726-5 tRNA-Cys
    2222. Escherichia sp. 79.0191 tRNA-Cys
    2223. Escherichia sp. 8.2195 tRNA-Cys
    2224. Escherichia sp. 92.1228 tRNA-Cys
    2225. Escherichia sp. 93.0724 tRNA-Cys
    2226. Escherichia sp. 93.0743 tRNA-Cys
    2227. Escherichia sp. 93.0750 tRNA-Cys
    2228. Escherichia sp. 93.0816 tRNA-Cys
    2229. Escherichia sp. 93.1447 tRNA-Cys
    2230. Escherichia sp. 93.1462 tRNA-Cys
    2231. Escherichia sp. 93.1518 tRNA-Cys
    2232. Escherichia sp. 94.0001 tRNA-Cys
    2233. Escherichia sp. E10V10 tRNA-Cys
    2234. Escherichia sp. E10V4 tRNA-Cys
    2235. Escherichia sp. E10V5 tRNA-Cys
    2236. Escherichia sp. E1130 tRNA-Cys
    2237. Escherichia sp. E13S3 tRNA-Cys
    2238. Escherichia sp. E14S1 tRNA-Cys
    2239. Escherichia sp. E14V10 tRNA-Cys
    2240. Escherichia sp. E14V5 tRNA-Cys
    2241. Escherichia sp. E14V7 tRNA-Cys
    2242. Escherichia sp. E1S7 tRNA-Cys
    2243. Escherichia sp. E1V33 tRNA-Cys
    2244. Escherichia sp. E2562 tRNA-Cys
    2245. Escherichia sp. E2586 tRNA-Cys
    2246. Escherichia sp. E2593 tRNA-Cys
    2247. Escherichia sp. E2661 tRNA-Cys
    2248. Escherichia sp. E2748 tRNA-Cys
    2249. Escherichia sp. E3356 tRNA-Cys
    2250. Escherichia sp. E3659 tRNA-Cys
    2251. Escherichia sp. E4208 tRNA-Cys
    2252. Escherichia sp. E4385 tRNA-Cys
    2253. Escherichia sp. E4694 tRNA-Cys
    2254. Escherichia sp. E4702 tRNA-Cys
    2255. Escherichia sp. E4736 tRNA-Cys
    2256. Escherichia sp. E4742 tRNA-Cys
    2257. Escherichia sp. E4930 tRNA-Cys
    2258. Escherichia sp. E5028 tRNA-Cys
    2259. Escherichia sp. Gen1 tRNA-Cys
    2260. Escherichia sp. HH26CH tRNA-Cys
    2261. Escherichia sp. HH41S tRNA-Cys
    2262. Escherichia sp. JL983 tRNA-Cys
    2263. Escherichia sp. KCJ4928 tRNA-Cys
    2264. Escherichia sp. KCJ4943 tRNA-Cys
    2265. Escherichia sp. KTE114 tRNA-Cys
    2266. Escherichia sp. KTE11 tRNA-Cys
    2267. Escherichia sp. KTE159 tRNA-Cys
    2268. Escherichia sp. KTE172 tRNA-Cys
    2269. Escherichia sp. KTE31 tRNA-Cys
    2270. Escherichia sp. KTE52 tRNA-Cys
    2271. Escherichia sp. KTE96 tRNA-Cys
    2272. Escherichia sp. MOD1-EC5451 tRNA-Cys
    2273. Escherichia sp. MOD1-EC6475 tRNA-Cys
    2274. Escherichia sp. MR tRNA-Cys
    2275. Escherichia sp. R8 tRNA-Cys
    2276. Escherichia whittamii tRNA-Cys
    2277. Escherichia sp. SCLE84 tRNA-Cys
    2278. Escherichia sp. TC-EC600-tetX4 tRNA-Cys
    2279. Escherichia sp. TM-G17TGC tRNA-Cys
    2280. Escherichia sp. tRNA-Cys
    2281. Ewingella americana ATCC 33852 tRNA-Cys
    2282. Ewingella americana tRNA-Cys
    2283. Gibbsiella quercinecans tRNA-Cys
    2284. Hafnia alvei ATCC 51873 tRNA-Cys
    2285. Hafnia alvei tRNA-Cys
    2286. Hafnia paralvei ATCC 29927 tRNA-Cys
    2287. Hafnia paralvei tRNA-Cys
    2288. Hafnia sp. HMSC23F03 tRNA-Cys
    2289. Klebsiella oxytoca tRNA-Cys(gca)
    2290. Klebsiella pneumoniae tRNA-Cys(gca)
    2291. Listeria monocytogenes tRNA-Cys
    2292. Mangrovibacter phragmitis tRNA-Cys
    2293. Obesumbacterium proteus ATCC 12841 tRNA-Cys
    2294. Obesumbacterium proteus tRNA-Cys
    2295. Pectobacterium aquaticum tRNA-Cys
    2296. Pectobacterium aroidearum tRNA-Cys
    2297. Pectobacterium atrosepticum ICMP 1526 tRNA-Cys
    2298. Pectobacterium atrosepticum SCRI1043 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2299. Pectobacterium atrosepticum tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2300. Pectobacterium betavasculorum tRNA-Cys
    2301. Pectobacterium actinidiae tRNA-Cys
    2302. Pectobacterium brasiliense tRNA-Cys
    2303. Pectobacterium brasiliense ICMP 19477 tRNA-Cys
    2304. Pectobacterium carotovorum subsp. carotovorum ICMP 5702 tRNA-Cys
    2305. Pectobacterium carotovorum subsp. carotovorum PC1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2306. Pectobacterium carotovorum subsp. carotovorum PCC21 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2307. Pectobacterium carotovorum subsp. carotovorum tRNA-Cys
    2308. Pectobacterium carotovorum subsp. carotovorum UGC32 tRNA-Cys
    2309. Pectobacterium carotovorum tRNA-Cys
    2310. Pectobacterium odoriferum tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2311. Pectobacterium peruviense tRNA-Cys
    2312. Pectobacterium polaris tRNA-Cys
    2313. Pectobacterium polonicum tRNA-Cys
    2314. Pectobacterium punjabense tRNA-Cys
    2315. Pectobacterium versatile tRNA-Cys
    2316. Pectobacterium versatile tRNA-Cys
    2317. Pectobacterium versatile tRNA-Cys
    2318. Pectobacterium versatile tRNA-Cys
    2319. Pectobacterium versatile tRNA-Cys
    2320. Pectobacterium sp. CFBP8739 tRNA-Cys
    2321. Pectobacterium versatile tRNA-Cys
    2322. Pseudomonas reactans tRNA-Cys
    2323. Salmonella bongori CFSAN000510 tRNA-Cys
    2324. Salmonella bongori N268-08 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2325. Salmonella bongori NCTC 12419 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2326. Salmonella bongori serovar 40:z35:- str. 95-0123 tRNA-Cys
    2327. Salmonella bongori serovar 40:z35:- tRNA-Cys
    2328. Salmonella bongori serovar 44:r:- tRNA-Cys
    2329. Salmonella bongori serovar 48:i:- str. 94-0708 tRNA-Cys
    2330. Salmonella bongori serovar 48:i:- tRNA-Cys
    2331. Salmonella bongori serovar 48:z35:- tRNA-Cys
    2332. Salmonella bongori serovar 48:z41:-- str. RKS3044 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2333. Salmonella bongori serovar 66:z41:- str. SA19983605 tRNA-Cys
    2334. Salmonella bongori serovar 66:z65:- tRNA-Cys
    2335. Salmonella bongori tRNA-Cys(gca)
    2336. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 32450 tRNA-Cys
    2337. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 32457 tRNA-Cys
    2338. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43478 tRNA-Cys
    2339. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43479 tRNA-Cys
    2340. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43480 tRNA-Cys
    2341. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43481 tRNA-Cys
    2342. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43482 tRNA-Cys
    2343. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18383 tRNA-Cys
    2344. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18503 tRNA-Cys
    2345. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18554 tRNA-Cys
    2346. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N20028 tRNA-Cys
    2347. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N23850 tRNA-Cys
    2348. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N25373 tRNA-Cys
    2349. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26624 tRNA-Cys
    2350. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26625 tRNA-Cys
    2351. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26626 tRNA-Cys
    2352. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26928 tRNA-Cys
    2353. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N27 tRNA-Cys
    2354. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N29354 tRNA-Cys
    2355. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N4410 tRNA-Cys
    2356. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N5 tRNA-Cys
    2357. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N6509 tRNA-Cys
    2358. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N7307 tRNA-Cys
    2359. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N9135 tRNA-Cys
    2360. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- tRNA-Cys
    2361. Salmonella enterica subsp. arizonae serovar 18:z4,z32:- tRNA-Cys
    2362. Salmonella enterica subsp. arizonae serovar 40:z4,z23:- tRNA-Cys
    2363. Salmonella enterica subsp. arizonae serovar 41:z4,z23:- str. 01-0089 tRNA-Cys
    2364. Salmonella enterica subsp. arizonae serovar 41:z4,z23:- tRNA-Cys
    2365. Salmonella enterica subsp. arizonae serovar 44:z4,z23,z32:- tRNA-Cys
    2366. Salmonella enterica subsp. arizonae serovar 47:z4,z23:- tRNA-Cys
    2367. Salmonella enterica subsp. arizonae serovar 48:z4,z24:- tRNA-Cys
    2368. Salmonella enterica subsp. arizonae serovar 50:r:z tRNA-Cys
    2369. Salmonella enterica subsp. arizonae serovar 51:g,z51:- tRNA-Cys
    2370. Salmonella enterica subsp. arizonae serovar 53:-:- str. SA20100345 tRNA-Cys
    2371. Salmonella enterica subsp. arizonae serovar 62:z36:- str. 5335/86 tRNA-Cys
    2372. Salmonella enterica subsp. arizonae serovar 62:z36:- str. RKS2983 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2373. Salmonella enterica subsp. arizonae serovar 62:z36:- tRNA-Cys
    2374. Salmonella enterica subsp. arizonae serovar 62:z4,z23:- tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2375. Salmonella enterica subsp. arizonae serovar 63:g,z51:- str. So 20/20 tRNA-Cys
    2376. Salmonella enterica subsp. arizonae str. CFSAN000560 tRNA-Cys
    2377. Salmonella enterica subsp. arizonae tRNA-Cys(gca)
    2378. Salmonella enterica subsp. diarizonae serovar 11:k:z53 tRNA-Cys
    2379. Salmonella enterica subsp. diarizonae serovar 16:z10:e,n,x,z15 tRNA-Cys
    2380. Salmonella enterica subsp. diarizonae serovar 38:[k]:- tRNA-Cys
    2381. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35 tRNA-Cys
    2382. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35:- tRNA-Cys
    2383. Salmonella enterica subsp. diarizonae serovar 38:k:z tRNA-Cys
    2384. Salmonella enterica subsp. diarizonae serovar 47:k:z35 tRNA-Cys
    2385. Salmonella enterica subsp. diarizonae serovar 48:i:z tRNA-Cys
    2386. Salmonella enterica subsp. diarizonae serovar 50:k:z str. MZ0080 tRNA-Cys
    2387. Salmonella enterica subsp. diarizonae serovar 50:k:z tRNA-Cys
    2388. Salmonella enterica subsp. diarizonae serovar 50:l,v:z35 tRNA-Cys
    2389. Salmonella enterica subsp. diarizonae serovar 50:r:z tRNA-Cys
    2390. Salmonella enterica subsp. diarizonae serovar 50:z:z52 tRNA-Cys
    2391. Salmonella enterica subsp. diarizonae serovar 53:z10:- tRNA-Cys
    2392. Salmonella enterica subsp. diarizonae serovar 59:[k]:z35 tRNA-Cys
    2393. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 str. 01-0170 tRNA-Cys
    2394. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 tRNA-Cys
    2395. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,(7) tRNA-Cys
    2396. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,7 tRNA-Cys
    2397. Salmonella enterica subsp. diarizonae serovar 61:r:z tRNA-Cys
    2398. Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 tRNA-Cys
    2399. Salmonella enterica subsp. diarizonae serovar 65:z10:e,n,x,z15 tRNA-Cys
    2400. Salmonella enterica subsp. diarizonae serovar b,50:-:- tRNA-Cys
    2401. Salmonella enterica subsp. diarizonae serovar Rough:r:z tRNA-Cys
    2402. Salmonella enterica subsp. diarizonae serovar Rough:-:- tRNA-Cys
    2403. Salmonella enterica subsp. diarizonae str. CFSAN000553 tRNA-Cys
    2404. Salmonella enterica subsp. diarizonae str. CFSAN000558 tRNA-Cys
    2405. Salmonella enterica subsp. diarizonae tRNA-Cys(gca)
    2406. Salmonella enterica subsp. enterica serovar 13,23:b:- tRNA-Cys
    2407. Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- tRNA-Cys
    2408. Salmonella enterica subsp. enterica serovar 16:b:- tRNA-Cys
    2409. Salmonella enterica subsp. enterica serovar 1,9,12:-:- tRNA-Cys
    2410. Salmonella enterica subsp. enterica serovar 3,10:e,h:- tRNA-Cys
    2411. Salmonella enterica subsp. enterica serovar 4,12:d:- tRNA-Cys
    2412. Salmonella enterica subsp. enterica serovar 4,12:i:- tRNA-Cys
    2413. Salmonella enterica subsp. enterica serovar 43:a:1,7 tRNA-Cys
    2414. Salmonella enterica subsp. enterica serovar 4,[5],12:b:- tRNA-Cys
    2415. Salmonella enterica subsp. enterica serovar 4,5,12:b:- tRNA-Cys
    2416. Salmonella enterica subsp. enterica serovar 4,[5],12:d:- tRNA-Cys
    2417. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1700 tRNA-Cys
    2418. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2419. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1739 tRNA-Cys
    2420. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701 tRNA-Cys
    2421. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- tRNA-Cys
    2422. Salmonella enterica subsp. enterica serovar 4,5,12:i tRNA-Cys
    2423. Salmonella enterica subsp. enterica serovar 4,5,12:i- tRNA-Cys
    2424. Salmonella enterica subsp. enterica serovar 4,[5],12:r:- tRNA-Cys
    2425. Salmonella enterica subsp. enterica serovar 6,7,14:g,m[p],s:[1,2,7] tRNA-Cys
    2426. Salmonella enterica subsp. enterica serovar 6,7:-:1,5 tRNA-Cys
    2427. Salmonella enterica subsp. enterica serovar 6,7:-1,5 tRNA-Cys
    2428. Salmonella enterica subsp. enterica serovar 6,7:b:- tRNA-Cys
    2429. Salmonella enterica subsp. enterica serovar 6,7:c:1,5 tRNA-Cys
    2430. Salmonella enterica subsp. enterica serovar 6,7:e,h:- tRNA-Cys
    2431. Salmonella enterica subsp. enterica serovar 6,7:k:- tRNA-Cys
    2432. Salmonella enterica subsp. enterica serovar 6,8:d:- tRNA-Cys
    2433. Salmonella enterica subsp. enterica serovar 6,8:i:- tRNA-Cys
    2434. Salmonella enterica subsp. enterica serovar 8,(20):i:- tRNA-Cys
    2435. Salmonella enterica subsp. enterica serovar 8,(20):-:z6 tRNA-Cys
    2436. Salmonella enterica subsp. enterica serovar 9,12:-:1,5 tRNA-Cys
    2437. Salmonella enterica subsp. enterica serovar 9,12:l,v:- str. 94293 tRNA-Cys
    2438. Salmonella enterica subsp. enterica serovar 9,12:l,z28:- tRNA-Cys
    2439. Salmonella enterica subsp. enterica serovar Abaetetuba str. ATCC 35640 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2440. Salmonella enterica subsp. enterica serovar Abaetetuba tRNA-Cys
    2441. Salmonella enterica subsp. enterica serovar Aba tRNA-Cys
    2442. Salmonella enterica subsp. enterica serovar Aberdeen tRNA-Cys(gca)
    2443. Salmonella enterica subsp. enterica serovar Abony str. 0014 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2444. Salmonella enterica subsp. enterica serovar Abony tRNA-Cys
    2445. Salmonella enterica subsp. enterica serovar Abortusequi tRNA-Cys
    2446. Salmonella enterica subsp. enterica serovar Abortusovis tRNA-Cys
    2447. Salmonella enterica subsp. enterica serovar Adabraka tRNA-Cys
    2448. Salmonella enterica subsp. enterica serovar Adamstua tRNA-Cys
    2449. Salmonella enterica subsp. enterica serovar Adelaide str. A4-669 tRNA-Cys
    2450. Salmonella enterica subsp. enterica serovar Adelaide tRNA-Cys
    2451. Salmonella enterica subsp. enterica serovar Adjame tRNA-Cys
    2452. Salmonella enterica subsp. enterica serovar Afula tRNA-Cys
    2453. Salmonella enterica subsp. enterica serovar Agama tRNA-Cys
    2454. Salmonella enterica subsp. enterica serovar Agbeni tRNA-Cys
    2455. Salmonella enterica subsp. enterica serovar Agona str. 0292 tRNA-Cys
    2456. Salmonella enterica subsp. enterica serovar Agona str. 0322 tRNA-Cys
    2457. Salmonella enterica subsp. enterica serovar Agona str. 241981 tRNA-Cys
    2458. Salmonella enterica subsp. enterica serovar Agona str. 24249 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2459. Salmonella enterica subsp. enterica serovar Agona str. 246555-3 tRNA-Cys
    2460. Salmonella enterica subsp. enterica serovar Agona str. 266757-1 tRNA-Cys
    2461. Salmonella enterica subsp. enterica serovar Agona str. 311387-1 tRNA-Cys
    2462. Salmonella enterica subsp. enterica serovar Agona str. 339787 tRNA-Cys
    2463. Salmonella enterica subsp. enterica serovar Agona str. 392869-1 tRNA-Cys
    2464. Salmonella enterica subsp. enterica serovar Agona str. 392869-2 tRNA-Cys
    2465. Salmonella enterica subsp. enterica serovar Agona str. 400095 11 tRNA-Cys
    2466. Salmonella enterica subsp. enterica serovar Agona str. 400095 13 tRNA-Cys
    2467. Salmonella enterica subsp. enterica serovar Agona str. 400095 14 tRNA-Cys
    2468. Salmonella enterica subsp. enterica serovar Agona str. 400095 17 tRNA-Cys
    2469. Salmonella enterica subsp. enterica serovar Agona str. 400095 18 tRNA-Cys
    2470. Salmonella enterica subsp. enterica serovar Agona str. 400095 19 tRNA-Cys
    2471. Salmonella enterica subsp. enterica serovar Agona str. 400095 22 tRNA-Cys
    2472. Salmonella enterica subsp. enterica serovar Agona str. 400096 16 tRNA-Cys
    2473. Salmonella enterica subsp. enterica serovar Agona str. 400100 30-11 tRNA-Cys
    2474. Salmonella enterica subsp. enterica serovar Agona str. 400100 5-3 tRNA-Cys
    2475. Salmonella enterica subsp. enterica serovar Agona str. 400100 6-5 tRNA-Cys
    2476. Salmonella enterica subsp. enterica serovar Agona str. 400100 7-9 tRNA-Cys
    2477. Salmonella enterica subsp. enterica serovar Agona str. 409753-6 tRNA-Cys
    2478. Salmonella enterica subsp. enterica serovar Agona str. 419639 2-1 tRNA-Cys
    2479. Salmonella enterica subsp. enterica serovar Agona str. 432613 tRNA-Cys
    2480. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-4 tRNA-Cys
    2481. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-5 tRNA-Cys
    2482. Salmonella enterica subsp. enterica serovar Agona str. 447967 1-1 tRNA-Cys
    2483. Salmonella enterica subsp. enterica serovar Agona str. 447967 2-1 tRNA-Cys
    2484. Salmonella enterica subsp. enterica serovar Agona str. 460004 1-1 tRNA-Cys
    2485. Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2486. Salmonella enterica subsp. enterica serovar Agona str. 467481 tRNA-Cys
    2487. Salmonella enterica subsp. enterica serovar Agona str. 557928 tRNA-Cys
    2488. Salmonella enterica subsp. enterica serovar Agona str. 620239 tRNA-Cys
    2489. Salmonella enterica subsp. enterica serovar Agona str. 632182-2 tRNA-Cys
    2490. Salmonella enterica subsp. enterica serovar Agona str. 648586-1 tRNA-Cys
    2491. Salmonella enterica subsp. enterica serovar Agona str. ATCC 51957 tRNA-Cys
    2492. Salmonella enterica subsp. enterica serovar Agona str. ATCC BAA-707 tRNA-Cys
    2493. Salmonella enterica subsp. enterica serovar Agona str. SA-1 tRNA-Cys
    2494. Salmonella enterica subsp. enterica serovar Agona str. SA-2 tRNA-Cys
    2495. Salmonella enterica subsp. enterica serovar Agona str. SA-3 tRNA-Cys
    2496. Salmonella enterica subsp. enterica serovar Agona str. SA-4 tRNA-Cys
    2497. Salmonella enterica subsp. enterica serovar Agona str. SA-5 tRNA-Cys
    2498. Salmonella enterica subsp. enterica serovar Agona str. SH08SF124 tRNA-Cys
    2499. Salmonella enterica subsp. enterica serovar Agona str. SH10GFN094 tRNA-Cys
    2500. Salmonella enterica subsp. enterica serovar Agona str. SH11G1113 tRNA-Cys
    2501. Salmonella enterica subsp. enterica serovar Agona str. SL483 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2502. Salmonella enterica subsp. enterica serovar Agona tRNA-Cys
    2503. Salmonella enterica subsp. enterica serovar Ago tRNA-Cys
    2504. Salmonella enterica subsp. enterica serovar Agoueve tRNA-Cys
    2505. Salmonella enterica subsp. enterica serovar Ahuza tRNA-Cys
    2506. Salmonella enterica subsp. enterica serovar Ajiobo tRNA-Cys
    2507. Salmonella enterica subsp. enterica serovar Akanji tRNA-Cys
    2508. Salmonella enterica subsp. enterica serovar Alachua str. R6-377 tRNA-Cys
    2509. Salmonella enterica subsp. enterica serovar Alachua tRNA-Cys
    2510. Salmonella enterica subsp. enterica serovar Albany str. ATCC 51960 tRNA-Cys
    2511. Salmonella enterica subsp. enterica serovar Albany tRNA-Cys
    2512. Salmonella enterica subsp. enterica serovar Albert tRNA-Cys
    2513. Salmonella enterica subsp. enterica serovar Altendorf tRNA-Cys
    2514. Salmonella enterica subsp. enterica serovar Altona tRNA-Cys
    2515. Salmonella enterica subsp. enterica serovar Amager tRNA-Cys
    2516. Salmonella enterica subsp. enterica serovar Amersfoort tRNA-Cys
    2517. Salmonella enterica subsp. enterica serovar Amoutive tRNA-Cys
    2518. Salmonella enterica subsp. enterica serovar Amsterdam tRNA-Cys
    2519. Salmonella enterica subsp. enterica serovar Amsterdam var. 15+,34+ tRNA-Cys
    2520. Salmonella enterica subsp. enterica serovar Anatum str. ATCC BAA-1592 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2521. Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2522. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 tRNA-Cys
    2523. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003962 tRNA-Cys
    2524. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003963 tRNA-Cys
    2525. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003964 tRNA-Cys
    2526. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003967 tRNA-Cys
    2527. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003970 tRNA-Cys
    2528. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003971 tRNA-Cys
    2529. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003972 tRNA-Cys
    2530. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003973 tRNA-Cys
    2531. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003974 tRNA-Cys
    2532. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003975 tRNA-Cys
    2533. Salmonella enterica subsp. enterica serovar Anatum str. USDA 100 tRNA-Cys
    2534. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2535. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 tRNA-Cys
    2536. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 tRNA-Cys
    2537. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 tRNA-Cys
    2538. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 tRNA-Cys
    2539. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 tRNA-Cys
    2540. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 tRNA-Cys
    2541. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 tRNA-Cys
    2542. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 tRNA-Cys
    2543. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 tRNA-Cys
    2544. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 tRNA-Cys
    2545. Salmonella enterica subsp. enterica serovar Anatum tRNA-Cys
    2546. Salmonella enterica subsp. enterica serovar Anatum var. 15+ tRNA-Cys
    2547. Salmonella enterica subsp. enterica serovar Anderlecht tRNA-Cys
    2548. Salmonella enterica subsp. enterica serovar Anecho tRNA-Cys
    2549. Salmonella enterica subsp. enterica serovar Angoda tRNA-Cys
    2550. Salmonella enterica subsp. enterica serovar Ank tRNA-Cys
    2551. Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 tRNA-Cys
    2552. Salmonella enterica subsp. enterica serovar Antsalova tRNA-Cys
    2553. Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 tRNA-Cys
    2554. Salmonella enterica subsp. enterica serovar Apapa tRNA-Cys
    2555. Salmonella enterica subsp. enterica serovar Apeyeme tRNA-Cys
    2556. Salmonella enterica subsp. enterica serovar Aqua str. NVSL2001 tRNA-Cys
    2557. Salmonella enterica subsp. enterica serovar Arechavaleta tRNA-Cys
    2558. Salmonella enterica subsp. enterica serovar Aschersleben tRNA-Cys
    2559. Salmonella enterica subsp. enterica serovar Augustenborg tRNA-Cys
    2560. Salmonella enterica subsp. enterica serovar Austin tRNA-Cys
    2561. Salmonella enterica subsp. enterica serovar Baguida tRNA-Cys
    2562. Salmonella enterica subsp. enterica serovar Bahati tRNA-Cys
    2563. Salmonella enterica subsp. enterica serovar Baildon str. R6-199 tRNA-Cys
    2564. Salmonella enterica subsp. enterica serovar Baildon tRNA-Cys
    2565. Salmonella enterica subsp. enterica serovar Bakau tRNA-Cys
    2566. Salmonella enterica subsp. enterica serovar Ball tRNA-Cys
    2567. Salmonella enterica subsp. enterica serovar Banana tRNA-Cys
    2568. Salmonella enterica subsp. enterica serovar Bardo tRNA-Cys
    2569. Salmonella enterica subsp. enterica serovar Bareilly str. 2780 tRNA-Cys
    2570. Salmonella enterica subsp. enterica serovar Bareilly str. ATCC 9115 tRNA-Cys
    2571. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000178 tRNA-Cys
    2572. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000179 tRNA-Cys
    2573. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000180 tRNA-Cys
    2574. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000181 tRNA-Cys
    2575. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000182 tRNA-Cys
    2576. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000183 tRNA-Cys
    2577. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000184 tRNA-Cys
    2578. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000185 tRNA-Cys
    2579. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000186 tRNA-Cys
    2580. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000187 tRNA-Cys
    2581. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000188 tRNA-Cys
    2582. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000189 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2583. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000190 tRNA-Cys
    2584. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000191 tRNA-Cys
    2585. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000192 tRNA-Cys
    2586. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000193 tRNA-Cys
    2587. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000194 tRNA-Cys
    2588. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000195 tRNA-Cys
    2589. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000196 tRNA-Cys
    2590. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000197 tRNA-Cys
    2591. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000198 tRNA-Cys
    2592. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000199 tRNA-Cys
    2593. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000200 tRNA-Cys
    2594. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000201 tRNA-Cys
    2595. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000202 tRNA-Cys
    2596. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000203 tRNA-Cys
    2597. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000204 tRNA-Cys
    2598. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000205 tRNA-Cys
    2599. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000206 tRNA-Cys
    2600. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000207 tRNA-Cys
    2601. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000208 tRNA-Cys
    2602. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000209 tRNA-Cys
    2603. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000210 tRNA-Cys
    2604. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000211 tRNA-Cys
    2605. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000212 tRNA-Cys
    2606. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000213 tRNA-Cys
    2607. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000214 tRNA-Cys
    2608. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000215 tRNA-Cys
    2609. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000216 tRNA-Cys
    2610. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000217 tRNA-Cys
    2611. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000218 tRNA-Cys
    2612. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000219 tRNA-Cys
    2613. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000220 tRNA-Cys
    2614. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000221 tRNA-Cys
    2615. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000222 tRNA-Cys
    2616. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000223 tRNA-Cys
    2617. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000224 tRNA-Cys
    2618. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000225 tRNA-Cys
    2619. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000226 tRNA-Cys
    2620. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000227 tRNA-Cys
    2621. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000228 tRNA-Cys
    2622. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000229 tRNA-Cys
    2623. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000230 tRNA-Cys
    2624. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000231 tRNA-Cys
    2625. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000232 tRNA-Cys
    2626. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000233 tRNA-Cys
    2627. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000235 tRNA-Cys
    2628. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000236 tRNA-Cys
    2629. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000661 tRNA-Cys
    2630. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000662 tRNA-Cys
    2631. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 tRNA-Cys
    2632. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000680 tRNA-Cys
    2633. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000700 tRNA-Cys
    2634. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 tRNA-Cys
    2635. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000753 tRNA-Cys
    2636. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000754 tRNA-Cys
    2637. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000755 tRNA-Cys
    2638. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000951 tRNA-Cys
    2639. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000952 tRNA-Cys
    2640. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000953 tRNA-Cys
    2641. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000954 tRNA-Cys
    2642. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000955 tRNA-Cys
    2643. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000956 tRNA-Cys
    2644. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000957 tRNA-Cys
    2645. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000958 tRNA-Cys
    2646. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000959 tRNA-Cys
    2647. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000960 tRNA-Cys
    2648. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000961 tRNA-Cys
    2649. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000962 tRNA-Cys
    2650. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000963 tRNA-Cys
    2651. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000964 tRNA-Cys
    2652. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000965 tRNA-Cys
    2653. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000966 tRNA-Cys
    2654. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000967 tRNA-Cys
    2655. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 tRNA-Cys
    2656. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000969 tRNA-Cys
    2657. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000970 tRNA-Cys
    2658. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001087 tRNA-Cys
    2659. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001088 tRNA-Cys
    2660. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001089 tRNA-Cys
    2661. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001090 tRNA-Cys
    2662. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001099 tRNA-Cys
    2663. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001102 tRNA-Cys
    2664. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001105 tRNA-Cys
    2665. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001107 tRNA-Cys
    2666. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001108 tRNA-Cys
    2667. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001109 tRNA-Cys
    2668. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001111 tRNA-Cys
    2669. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001112 tRNA-Cys
    2670. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001114 tRNA-Cys
    2671. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001115 tRNA-Cys
    2672. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001117 tRNA-Cys
    2673. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001118 tRNA-Cys
    2674. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001140 tRNA-Cys
    2675. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001591 tRNA-Cys
    2676. Salmonella enterica subsp. enterica serovar Bareilly tRNA-Cys
    2677. Salmonella enterica subsp. enterica serovar Bargny tRNA-Cys
    2678. Salmonella enterica subsp. enterica serovar Barranquilla tRNA-Cys
    2679. Salmonella enterica subsp. enterica serovar Beaudesert tRNA-Cys
    2680. Salmonella enterica subsp. enterica serovar Benin tRNA-Cys
    2681. Salmonella enterica subsp. enterica serovar Bere tRNA-Cys
    2682. Salmonella enterica subsp. enterica serovar Bergen str. ST350 tRNA-Cys
    2683. Salmonella enterica subsp. enterica serovar Bergen tRNA-Cys
    2684. Salmonella enterica subsp. enterica serovar Berkeley tRNA-Cys
    2685. Salmonella enterica subsp. enterica serovar Berlin tRNA-Cys
    2686. Salmonella enterica subsp. enterica serovar Berta str. ATCC 8392 tRNA-Cys
    2687. Salmonella enterica subsp. enterica serovar Berta str. SA20103550 tRNA-Cys
    2688. Salmonella enterica subsp. enterica serovar Berta tRNA-Cys
    2689. Salmonella enterica subsp. enterica serovar Bietri tRNA-Cys
    2690. Salmonella enterica subsp. enterica serovar Bijlmer tRNA-Cys
    2691. Salmonella enterica subsp. enterica serovar Binza tRNA-Cys
    2692. Salmonella enterica subsp. enterica serovar Birkenhead tRNA-Cys
    2693. Salmonella enterica subsp. enterica serovar Bispebjerg tRNA-Cys
    2694. Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 tRNA-Cys
    2695. Salmonella enterica subsp. enterica serovar Blegdam tRNA-Cys
    2696. Salmonella enterica subsp. enterica serovar Blockley tRNA-Cys
    2697. Salmonella enterica subsp. enterica serovar Blukwa tRNA-Cys
    2698. Salmonella enterica subsp. enterica serovar Bochum tRNA-Cys
    2699. Salmonella enterica subsp. enterica serovar Bonariensis tRNA-Cys
    2700. Salmonella enterica subsp. enterica serovar Bonn tRNA-Cys
    2701. Salmonella enterica subsp. enterica serovar Borreze str. SA20041063 tRNA-Cys
    2702. Salmonella enterica subsp. enterica serovar Bovismorbificans str. 3114 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2703. Salmonella enterica subsp. enterica serovar Bovismorbificans str. Sal610 tRNA-Cys
    2704. Salmonella enterica subsp. enterica serovar Bovismorbificans tRNA-Cys(gca)
    2705. Salmonella enterica subsp. enterica serovar Braenderup str. ATCC BAA-664 tRNA-Cys
    2706. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN000756 tRNA-Cys
    2707. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN001740 tRNA-Cys
    2708. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN001745 tRNA-Cys
    2709. Salmonella enterica subsp. enterica serovar Braenderup tRNA-Cys(gca)
    2710. Salmonella enterica subsp. enterica serovar Brancaster tRNA-Cys
    2711. Salmonella enterica subsp. enterica serovar Brandenburg tRNA-Cys
    2712. Salmonella enterica subsp. enterica serovar Brazzaville tRNA-Cys
    2713. Salmonella enterica subsp. enterica serovar Breda tRNA-Cys
    2714. Salmonella enterica subsp. enterica serovar Bredeney str. CFSAN001080 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2715. Salmonella enterica subsp. enterica serovar Bredeney tRNA-Cys(gca)
    2716. Salmonella enterica subsp. enterica serovar Breukelen tRNA-Cys
    2717. Salmonella enterica subsp. enterica serovar Brevik tRNA-Cys
    2718. Salmonella enterica subsp. enterica serovar Brijbhumi tRNA-Cys
    2719. Salmonella enterica subsp. enterica serovar Bristol tRNA-Cys
    2720. Salmonella enterica subsp. enterica serovar Bron tRNA-Cys
    2721. Salmonella enterica subsp. enterica serovar Brunei tRNA-Cys
    2722. Salmonella enterica subsp. enterica serovar Bukavu tRNA-Cys
    2723. Salmonella enterica subsp. enterica serovar Butantan tRNA-Cys
    2724. Salmonella enterica subsp. enterica serovar Buzu tRNA-Cys
    2725. Salmonella enterica subsp. enterica serovar Cairina tRNA-Cys
    2726. Salmonella enterica subsp. enterica serovar California tRNA-Cys
    2727. Salmonella enterica subsp. enterica serovar Cannstatt tRNA-Cys
    2728. Salmonella enterica subsp. enterica serovar Caracas tRNA-Cys
    2729. Salmonella enterica subsp. enterica serovar Cardoner tRNA-Cys
    2730. Salmonella enterica subsp. enterica serovar Carmel tRNA-Cys
    2731. Salmonella enterica subsp. enterica serovar Carno tRNA-Cys
    2732. Salmonella enterica subsp. enterica serovar Carrau tRNA-Cys
    2733. Salmonella enterica subsp. enterica serovar Cerro str. FSL R8-0235 tRNA-Cys
    2734. Salmonella enterica subsp. enterica serovar Cerro str. 5569 tRNA-Cys
    2735. Salmonella enterica subsp. enterica serovar Cerro str. 818 tRNA-Cys
    2736. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001587 tRNA-Cys
    2737. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 tRNA-Cys
    2738. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001589 tRNA-Cys
    2739. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001590 tRNA-Cys
    2740. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001669 tRNA-Cys
    2741. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001670 tRNA-Cys
    2742. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001671 tRNA-Cys
    2743. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001673 tRNA-Cys
    2744. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001674 tRNA-Cys
    2745. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001679 tRNA-Cys
    2746. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001680 tRNA-Cys
    2747. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001681 tRNA-Cys
    2748. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001690 tRNA-Cys
    2749. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001691 tRNA-Cys
    2750. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001692 tRNA-Cys
    2751. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001697 tRNA-Cys
    2752. Salmonella enterica subsp. enterica serovar Cerro tRNA-Cys
    2753. Salmonella enterica subsp. enterica serovar Chailey tRNA-Cys
    2754. Salmonella enterica subsp. enterica serovar Champaign tRNA-Cys
    2755. Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 tRNA-Cys
    2756. Salmonella enterica subsp. enterica serovar Chester tRNA-Cys
    2757. Salmonella enterica subsp. enterica serovar Chicago tRNA-Cys
    2758. Salmonella enterica subsp. enterica serovar Chichester tRNA-Cys
    2759. Salmonella enterica subsp. enterica serovar Chittagong tRNA-Cys
    2760. Salmonella enterica subsp. enterica serovar Choleraesuis str. 0006 tRNA-Cys
    2761. Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708 tRNA-Cys
    2762. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000514 tRNA-Cys
    2763. Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2764. Salmonella enterica subsp. enterica serovar Choleraesuis str. SCSA50 tRNA-Cys
    2765. Salmonella enterica subsp. enterica serovar Choleraesuis tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2766. Salmonella enterica subsp. enterica serovar Clackamas tRNA-Cys
    2767. Salmonella enterica subsp. enterica serovar Coeln tRNA-Cys
    2768. Salmonella enterica subsp. enterica serovar Coleypark tRNA-Cys
    2769. Salmonella enterica subsp. enterica serovar Colindale tRNA-Cys
    2770. Salmonella enterica subsp. enterica serovar Colorado tRNA-Cys
    2771. Salmonella enterica subsp. enterica serovar Concord tRNA-Cys
    2772. Salmonella enterica subsp. enterica serovar Copenhagen tRNA-Cys
    2773. Salmonella enterica subsp. enterica serovar Coquilhatville tRNA-Cys
    2774. Salmonella enterica subsp. enterica serovar Corvallis tRNA-Cys
    2775. Salmonella enterica subsp. enterica serovar Cotham tRNA-Cys
    2776. Salmonella enterica subsp. enterica serovar Crossness str. 1422-74 tRNA-Cys
    2777. Salmonella enterica subsp. enterica serovar Cubana str. 76814 tRNA-Cys
    2778. Salmonella enterica subsp. enterica serovar Cubana str. CFSAN001083 tRNA-Cys
    2779. Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2780. Salmonella enterica subsp. enterica serovar Cubana str. CVM42234 tRNA-Cys
    2781. Salmonella enterica subsp. enterica serovar Cubana tRNA-Cys
    2782. Salmonella enterica subsp. enterica serovar Curacao tRNA-Cys
    2783. Salmonella enterica subsp. enterica serovar Dabou tRNA-Cys
    2784. Salmonella enterica subsp. enterica serovar Daytona tRNA-Cys(gca)
    2785. Salmonella enterica subsp. enterica serovar Decatur tRNA-Cys
    2786. Salmonella enterica subsp. enterica serovar Denver tRNA-Cys
    2787. Salmonella enterica subsp. enterica serovar Derby str. 626 tRNA-Cys
    2788. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000565 tRNA-Cys
    2789. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000566 tRNA-Cys
    2790. Salmonella enterica subsp. enterica serovar Derby tRNA-Cys(gca)
    2791. Salmonella enterica subsp. enterica serovar Dessau tRNA-Cys
    2792. Salmonella enterica subsp. enterica serovar Diguel tRNA-Cys
    2793. Salmonella enterica subsp. enterica serovar Djakarta str. S-1087 tRNA-Cys
    2794. Salmonella enterica subsp. enterica serovar Djugu tRNA-Cys
    2795. Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 tRNA-Cys
    2796. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000517 tRNA-Cys
    2797. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000518 tRNA-Cys
    2798. Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2799. Salmonella enterica subsp. enterica serovar Dublin str. DG22 tRNA-Cys
    2800. Salmonella enterica subsp. enterica serovar Dublin str. SA20093032 tRNA-Cys
    2801. Salmonella enterica subsp. enterica serovar Dublin str. SD3246 tRNA-Cys
    2802. Salmonella enterica subsp. enterica serovar Dublin str. SL1438 tRNA-Cys
    2803. Salmonella enterica subsp. enterica serovar Dublin str. UC16 tRNA-Cys
    2804. Salmonella enterica subsp. enterica serovar Dublin tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2805. Salmonella enterica subsp. enterica serovar Duesseldorf tRNA-Cys
    2806. Salmonella enterica subsp. enterica serovar Dugbe tRNA-Cys
    2807. Salmonella enterica subsp. enterica serovar Duisburg tRNA-Cys
    2808. Salmonella enterica subsp. enterica serovar Durban tRNA-Cys
    2809. Salmonella enterica subsp. enterica serovar Durham tRNA-Cys
    2810. Salmonella enterica subsp. enterica serovar Ealing tRNA-Cys
    2811. Salmonella enterica subsp. enterica serovar Eastbourne str. CFSAN001084 tRNA-Cys
    2812. Salmonella enterica subsp. enterica serovar Eastbourne tRNA-Cys
    2813. Salmonella enterica subsp. enterica serovar Eboko tRNA-Cys
    2814. Salmonella enterica subsp. enterica serovar Eingedi tRNA-Cys
    2815. Salmonella enterica subsp. enterica serovar Ekotedo tRNA-Cys
    2816. Salmonella enterica subsp. enterica serovar Eko tRNA-Cys
    2817. Salmonella enterica subsp. enterica serovar Ekpoui tRNA-Cys
    2818. Salmonella enterica subsp. enterica serovar Elisabethville tRNA-Cys
    2819. Salmonella enterica subsp. enterica serovar Elomrane tRNA-Cys
    2820. Salmonella enterica subsp. enterica serovar Emek tRNA-Cys
    2821. Salmonella enterica subsp. enterica serovar Enteritidis str. 08-1080 tRNA-Cys
    2822. Salmonella enterica subsp. enterica serovar Enteritidis str. 10-34587 tRNA-Cys
    2823. Salmonella enterica subsp. enterica serovar Enteritidis str. 13183-1 tRNA-Cys
    2824. Salmonella enterica subsp. enterica serovar Enteritidis str. 13-1 tRNA-Cys
    2825. Salmonella enterica subsp. enterica serovar Enteritidis str. 17927 tRNA-Cys
    2826. Salmonella enterica subsp. enterica serovar Enteritidis str. 18569 tRNA-Cys
    2827. Salmonella enterica subsp. enterica serovar Enteritidis str. 20037 tRNA-Cys
    2828. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K0958 tRNA-Cys
    2829. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K1651 tRNA-Cys
    2830. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K1726 tRNA-Cys
    2831. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0262 tRNA-Cys
    2832. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0267 tRNA-Cys
    2833. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0271 tRNA-Cys
    2834. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0284 tRNA-Cys
    2835. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0286 tRNA-Cys
    2836. Salmonella enterica subsp. enterica serovar Enteritidis str. 22510-1 tRNA-Cys
    2837. Salmonella enterica subsp. enterica serovar Enteritidis str. 22558 tRNA-Cys
    2838. Salmonella enterica subsp. enterica serovar Enteritidis str. 22704 tRNA-Cys
    2839. Salmonella enterica subsp. enterica serovar Enteritidis str. 33944 tRNA-Cys
    2840. Salmonella enterica subsp. enterica serovar Enteritidis str. 3402 tRNA-Cys
    2841. Salmonella enterica subsp. enterica serovar Enteritidis str. 436 tRNA-Cys
    2842. Salmonella enterica subsp. enterica serovar Enteritidis str. 485549-17 tRNA-Cys
    2843. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-3079 tRNA-Cys
    2844. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-5646 tRNA-Cys
    2845. Salmonella enterica subsp. enterica serovar Enteritidis str. 53-407 tRNA-Cys
    2846. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 22-17 tRNA-Cys
    2847. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 40-18 tRNA-Cys
    2848. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 42-20 tRNA-Cys
    2849. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 1-1 tRNA-Cys
    2850. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 9-7 tRNA-Cys
    2851. Salmonella enterica subsp. enterica serovar Enteritidis str. 576709 tRNA-Cys
    2852. Salmonella enterica subsp. enterica serovar Enteritidis str. 58-6482 tRNA-Cys
    2853. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-22 tRNA-Cys
    2854. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-70 tRNA-Cys
    2855. Salmonella enterica subsp. enterica serovar Enteritidis str. 6.0562-1 tRNA-Cys
    2856. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-2 tRNA-Cys
    2857. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-6 tRNA-Cys
    2858. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-16 tRNA-Cys
    2859. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-19 tRNA-Cys
    2860. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-9 tRNA-Cys
    2861. Salmonella enterica subsp. enterica serovar Enteritidis str. 62-1976 tRNA-Cys
    2862. Salmonella enterica subsp. enterica serovar Enteritidis str. 622731-39 tRNA-Cys
    2863. Salmonella enterica subsp. enterica serovar Enteritidis str. 629163 tRNA-Cys
    2864. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-26 tRNA-Cys
    2865. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-37 tRNA-Cys
    2866. Salmonella enterica subsp. enterica serovar Enteritidis str. 635290-58 tRNA-Cys
    2867. Salmonella enterica subsp. enterica serovar Enteritidis str. 638970-15 tRNA-Cys
    2868. Salmonella enterica subsp. enterica serovar Enteritidis str. 639016-6 tRNA-Cys
    2869. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-46 tRNA-Cys
    2870. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-50 tRNA-Cys
    2871. Salmonella enterica subsp. enterica serovar Enteritidis str. 640631 tRNA-Cys
    2872. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 4-1 tRNA-Cys
    2873. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 8-1 tRNA-Cys
    2874. Salmonella enterica subsp. enterica serovar Enteritidis str. 642046 4-7 tRNA-Cys
    2875. Salmonella enterica subsp. enterica serovar Enteritidis str. 648898 4-5 tRNA-Cys
    2876. Salmonella enterica subsp. enterica serovar Enteritidis str. 648899 3-17 tRNA-Cys
    2877. Salmonella enterica subsp. enterica serovar Enteritidis str. 648900 1-16 tRNA-Cys
    2878. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 1-17 tRNA-Cys
    2879. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 16-16 tRNA-Cys
    2880. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 39-2 tRNA-Cys
    2881. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 6-18 tRNA-Cys
    2882. Salmonella enterica subsp. enterica serovar Enteritidis str. 648902 6-8 tRNA-Cys
    2883. Salmonella enterica subsp. enterica serovar Enteritidis str. 648903 1-6 tRNA-Cys
    2884. Salmonella enterica subsp. enterica serovar Enteritidis str. 648904 3-6 tRNA-Cys
    2885. Salmonella enterica subsp. enterica serovar Enteritidis str. 648905 5-18 tRNA-Cys
    2886. Salmonella enterica subsp. enterica serovar Enteritidis str. 653049 13-19 tRNA-Cys
    2887. Salmonella enterica subsp. enterica serovar Enteritidis str. 76-2651 tRNA-Cys
    2888. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-0424 tRNA-Cys
    2889. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2890. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-2659 tRNA-Cys
    2891. Salmonella enterica subsp. enterica serovar Enteritidis str. 78-1757 tRNA-Cys
    2892. Salmonella enterica subsp. enterica serovar Enteritidis str. 81-2625 tRNA-Cys
    2893. Salmonella enterica subsp. enterica serovar Enteritidis str. 8b-1 tRNA-Cys
    2894. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0895 tRNA-Cys
    2895. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0899 tRNA-Cys
    2896. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0956 tRNA-Cys
    2897. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2898. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1010 tRNA-Cys
    2899. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1018 tRNA-Cys
    2900. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1441 tRNA-Cys
    2901. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1444 tRNA-Cys
    2902. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1445 tRNA-Cys
    2903. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1455 tRNA-Cys
    2904. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1457 tRNA-Cys
    2905. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1543 tRNA-Cys
    2906. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1558 tRNA-Cys
    2907. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1559 tRNA-Cys
    2908. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1565 tRNA-Cys
    2909. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1566 tRNA-Cys
    2910. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1575 tRNA-Cys
    2911. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1580 tRNA-Cys
    2912. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1594 tRNA-Cys
    2913. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1725 tRNA-Cys
    2914. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1729 tRNA-Cys
    2915. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1745 tRNA-Cys
    2916. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1747 tRNA-Cys
    2917. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1791 tRNA-Cys
    2918. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1795 tRNA-Cys
    2919. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1808 tRNA-Cys
    2920. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1810 tRNA-Cys
    2921. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1811 tRNA-Cys
    2922. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1882 tRNA-Cys
    2923. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1884 tRNA-Cys
    2924. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000052 tRNA-Cys
    2925. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000568 tRNA-Cys
    2926. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS44 tRNA-Cys
    2927. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS4 tRNA-Cys
    2928. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_56-3991 tRNA-Cys
    2929. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_69-4941 tRNA-Cys
    2930. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_76-3618 tRNA-Cys
    2931. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_81-2490 tRNA-Cys
    2932. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_N202 tRNA-Cys
    2933. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090135 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2934. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090193 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2935. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090195 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2936. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090332 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2937. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090530 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2938. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090531 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2939. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090641 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2940. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090698 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2941. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090884 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2942. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100088 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2943. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100089 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2944. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100100 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2945. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100101 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2946. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100103 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2947. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100130 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2948. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100131 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2949. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100134 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2950. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100325 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2951. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110221 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2952. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110222 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2953. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110223 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2954. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110353 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2955. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110354 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2956. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110355 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2957. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110356 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2958. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110357 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2959. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110358 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2960. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110359 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2961. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110360 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2962. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110361 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2963. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111095 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2964. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111174 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2965. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111175 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2966. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111510 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2967. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111514 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2968. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111515 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2969. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111554 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2970. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111561 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2971. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111576 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2972. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120002 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2973. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120003 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2974. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120005 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2975. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120007 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2976. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120008 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2977. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120009 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2978. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120051 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2979. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120200 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2980. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120213 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2981. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120219 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2982. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120229 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2983. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120240 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2984. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120356 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2985. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120469 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2986. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120496 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2987. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120497 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2988. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120498 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2989. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120505 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2990. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120528 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2991. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120544 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2992. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120548 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2993. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120555 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2994. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120580 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2995. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120581 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2996. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120590 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2997. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120597 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2998. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120677 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2999. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120685 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3000. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120686 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3001. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120687 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3002. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120697 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3003. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120722 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3004. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120734 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3005. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120738 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3006. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120765 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3007. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120773 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3008. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120774 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3009. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120775 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3010. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120776 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3011. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120916 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3012. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120917 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3013. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120918 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3014. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120925 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3015. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120927 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3016. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120929 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3017. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120963 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3018. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120968 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3019. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120969 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3020. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120970 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3021. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120994 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3022. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121004 tRNA-Cys
    3023. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121175 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3024. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121176 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3025. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121177 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3026. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121178 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3027. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121179 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3028. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121180 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3029. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121541 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3030. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121542 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3031. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121671 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3032. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121672 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3033. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121689 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3034. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121744 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3035. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121746 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3036. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121747 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3037. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121748 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3038. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121750 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3039. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121751 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3040. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121753 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3041. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121765 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3042. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121812 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3043. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121825 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3044. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121826 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3045. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121969 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3046. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121970 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3047. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121976 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3048. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121986 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3049. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121989 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3050. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121990 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3051. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122022 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3052. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122026 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3053. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122031 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3054. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122033 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3055. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122045 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3056. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130345 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3057. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130346 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3058. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130347 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3059. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130348 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3060. Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3061. Salmonella enterica subsp. enterica serovar Enteritidis str. PT23 tRNA-Cys
    3062. Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 tRNA-Cys
    3063. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19930684 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3064. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19940857 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3065. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19942384 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3066. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19943269 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3067. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19960848 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3068. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19961622 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3069. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970510 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3070. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970769 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3071. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19971331 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3072. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19980677 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3073. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981522 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3074. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981857 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3075. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19982831 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3076. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19983126 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3077. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19992322 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3078. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19994216 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3079. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20082034 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3080. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083456 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3081. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083636 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3082. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084384 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3083. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084644 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3084. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084824 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3085. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20085285 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3086. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090419 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3087. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090435 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3088. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090877 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3089. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20091739 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3090. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20092320 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3091. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093266 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3092. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093421 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3093. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093430 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3094. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093538 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3095. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093543 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3096. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093784 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3097. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093788 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3098. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093950 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3099. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093977 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3100. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094079 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3101. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094177 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3102. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094301 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3103. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094350 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3104. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094352 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3105. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094383 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3106. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094389 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3107. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094521 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3108. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094642 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3109. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094682 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3110. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094803 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3111. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095309 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3112. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095440 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3113. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100239 tRNA-Cys
    3114. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100349 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3115. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20121703 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3116. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20123395 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3117. Salmonella enterica subsp. enterica serovar Enteritidis str. SARB17 tRNA-Cys
    3118. Salmonella enterica subsp. enterica serovar Enteritidis str. SE10 tRNA-Cys
    3119. Salmonella enterica subsp. enterica serovar Enteritidis str. SE15-1 tRNA-Cys
    3120. Salmonella enterica subsp. enterica serovar Enteritidis str. SE30663 tRNA-Cys
    3121. Salmonella enterica subsp. enterica serovar Enteritidis str. SE8a tRNA-Cys
    3122. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE001 tRNA-Cys
    3123. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE002 tRNA-Cys
    3124. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE003 tRNA-Cys
    3125. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE004 tRNA-Cys
    3126. Salmonella enterica subsp. enterica serovar Enteritidis str. SL909 tRNA-Cys
    3127. Salmonella enterica subsp. enterica serovar Enteritidis str. SL913 tRNA-Cys
    3128. Salmonella enterica subsp. enterica serovar Enteritidis tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3129. Salmonella enterica subsp. enterica serovar Enugu tRNA-Cys
    3130. Salmonella enterica subsp. enterica serovar Essen tRNA-Cys
    3131. Salmonella enterica subsp. enterica serovar Everleigh tRNA-Cys
    3132. Salmonella enterica subsp. enterica serovar Falkensee tRNA-Cys
    3133. Salmonella enterica subsp. enterica serovar Fallowfield tRNA-Cys
    3134. Salmonella enterica subsp. enterica serovar Fann tRNA-Cys
    3135. Salmonella enterica subsp. enterica serovar Fanti tRNA-Cys
    3136. Salmonella enterica subsp. enterica serovar Farmsen tRNA-Cys
    3137. Salmonella enterica subsp. enterica serovar Florida tRNA-Cys
    3138. Salmonella enterica subsp. enterica serovar Flottbek tRNA-Cys
    3139. Salmonella enterica subsp. enterica serovar Fluntern tRNA-Cys
    3140. Salmonella enterica subsp. enterica serovar Freetown tRNA-Cys
    3141. Salmonella enterica subsp. enterica serovar Fresno str. ST224 tRNA-Cys
    3142. Salmonella enterica subsp. enterica serovar Fresno tRNA-Cys
    3143. Salmonella enterica subsp. enterica serovar Frintrop tRNA-Cys
    3144. Salmonella enterica subsp. enterica serovar Fufu tRNA-Cys
    3145. Salmonella enterica subsp. enterica serovar Fulica tRNA-Cys
    3146. Salmonella enterica subsp. enterica serovar Gafsa tRNA-Cys
    3147. Salmonella enterica subsp. enterica serovar Galiema tRNA-Cys
    3148. Salmonella enterica subsp. enterica serovar Gallinarum/pullorum str. CDC1983-67 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3149. Salmonella enterica subsp. enterica serovar Gallinarum/pullorum str. FCAV198 tRNA-Cys
    3150. Salmonella enterica subsp. enterica serovar Gallinarum/pullorum str. RKS5078 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3151. Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3152. Salmonella enterica subsp. enterica serovar Gallinarum str. 9184 tRNA-Cys
    3153. Salmonella enterica subsp. enterica serovar Gallinarum str. CFSAN000571 tRNA-Cys
    3154. Salmonella enterica subsp. enterica serovar Gallinarum str. SG9 tRNA-Cys
    3155. Salmonella enterica subsp. enterica serovar Gallinarum tRNA-Cys(gca)
    3156. Salmonella enterica subsp. enterica serovar Gambia tRNA-Cys
    3157. Salmonella enterica subsp. enterica serovar Gaminara str. A4-567 tRNA-Cys
    3158. Salmonella enterica subsp. enterica serovar Gaminara str. ATCC BAA-711 tRNA-Cys
    3159. Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 tRNA-Cys
    3160. Salmonella enterica subsp. enterica serovar Gaminara tRNA-Cys
    3161. Salmonella enterica subsp. enterica serovar Garoli tRNA-Cys
    3162. Salmonella enterica subsp. enterica serovar Gatow tRNA-Cys
    3163. Salmonella enterica subsp. enterica serovar Gatuni tRNA-Cys
    3164. Salmonella enterica subsp. enterica serovar Gdansk tRNA-Cys
    3165. Salmonella enterica subsp. enterica serovar Georgia tRNA-Cys
    3166. Salmonella enterica subsp. enterica serovar Giessen tRNA-Cys
    3167. Salmonella enterica subsp. enterica serovar Give str. 564 tRNA-Cys
    3168. Salmonella enterica subsp. enterica serovar Give str. S5-487 tRNA-Cys
    3169. Salmonella enterica subsp. enterica serovar Give tRNA-Cys(gca)
    3170. Salmonella enterica subsp. enterica serovar Give var. 15 str. CFSAN004343 tRNA-Cys
    3171. Salmonella enterica subsp. enterica serovar Glostrup tRNA-Cys
    3172. Salmonella enterica subsp. enterica serovar Gloucester tRNA-Cys
    3173. Salmonella enterica subsp. enterica serovar Godesberg tRNA-Cys
    3174. Salmonella enterica subsp. enterica serovar Gokul tRNA-Cys
    3175. Salmonella enterica subsp. enterica serovar Goldcoast tRNA-Cys(gca)
    3176. Salmonella enterica subsp. enterica serovar Gombe tRNA-Cys
    3177. Salmonella enterica subsp. enterica serovar Goverdhan tRNA-Cys
    3178. Salmonella enterica subsp. enterica serovar Grumpensis tRNA-Cys
    3179. Salmonella enterica subsp. enterica serovar Gueuletapee tRNA-Cys
    3180. Salmonella enterica subsp. enterica serovar Guildford tRNA-Cys
    3181. Salmonella enterica subsp. enterica serovar Guinea tRNA-Cys
    3182. Salmonella enterica subsp. enterica serovar Haardt tRNA-Cys
    3183. Salmonella enterica subsp. enterica serovar Hadar str. ATCC 51956 tRNA-Cys
    3184. Salmonella enterica subsp. enterica serovar Hadar str. RI_05P066 tRNA-Cys
    3185. Salmonella enterica subsp. enterica serovar Hadar str. SA20026260 tRNA-Cys
    3186. Salmonella enterica subsp. enterica serovar Hadar tRNA-Cys
    3187. Salmonella enterica subsp. enterica serovar Haduna tRNA-Cys
    3188. Salmonella enterica subsp. enterica serovar Haga tRNA-Cys
    3189. Salmonella enterica subsp. enterica serovar Haifa tRNA-Cys
    3190. Salmonella enterica subsp. enterica serovar Halle tRNA-Cys
    3191. Salmonella enterica subsp. enterica serovar Hartford str. CFSAN001075 tRNA-Cys
    3192. Salmonella enterica subsp. enterica serovar Hartford tRNA-Cys(gca)
    3193. Salmonella enterica subsp. enterica serovar Hato tRNA-Cys
    3194. Salmonella enterica subsp. enterica serovar Havana str. CFSAN001082 tRNA-Cys
    3195. Salmonella enterica subsp. enterica serovar Havana tRNA-Cys(gca)
    3196. Salmonella enterica subsp. enterica serovar Hayindogo tRNA-Cys
    3197. Salmonella enterica subsp. enterica serovar Heidelberg str. 21381 tRNA-Cys
    3198. Salmonella enterica subsp. enterica serovar Heidelberg str. 24390 tRNA-Cys
    3199. Salmonella enterica subsp. enterica serovar Heidelberg str. 24393 tRNA-Cys
    3200. Salmonella enterica subsp. enterica serovar Heidelberg str. 29169 tRNA-Cys
    3201. Salmonella enterica subsp. enterica serovar Heidelberg str. 32507 tRNA-Cys
    3202. Salmonella enterica subsp. enterica serovar Heidelberg str. 41563 tRNA-Cys
    3203. Salmonella enterica subsp. enterica serovar Heidelberg str. 41565 tRNA-Cys
    3204. Salmonella enterica subsp. enterica serovar Heidelberg str. 41566 tRNA-Cys
    3205. Salmonella enterica subsp. enterica serovar Heidelberg str. 41567 tRNA-Cys
    3206. Salmonella enterica subsp. enterica serovar Heidelberg str. 41573 tRNA-Cys
    3207. Salmonella enterica subsp. enterica serovar Heidelberg str. 41576 tRNA-Cys
    3208. Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3209. Salmonella enterica subsp. enterica serovar Heidelberg str. 41579 tRNA-Cys
    3210. Salmonella enterica subsp. enterica serovar Heidelberg str. 41584 tRNA-Cys
    3211. Salmonella enterica subsp. enterica serovar Heidelberg str. 579082-8 tRNA-Cys
    3212. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-10 tRNA-Cys
    3213. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-19 tRNA-Cys
    3214. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-34 tRNA-Cys
    3215. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-5 tRNA-Cys
    3216. Salmonella enterica subsp. enterica serovar Heidelberg str. 607310-1 tRNA-Cys
    3217. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-11 tRNA-Cys
    3218. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-12 tRNA-Cys
    3219. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-14 tRNA-Cys
    3220. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-21 tRNA-Cys
    3221. Salmonella enterica subsp. enterica serovar Heidelberg str. 632675-24 tRNA-Cys
    3222. Salmonella enterica subsp. enterica serovar Heidelberg str. 640151-11 tRNA-Cys
    3223. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-3 tRNA-Cys
    3224. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-5 tRNA-Cys
    3225. Salmonella enterica subsp. enterica serovar Heidelberg str. 75-3547 tRNA-Cys
    3226. Salmonella enterica subsp. enterica serovar Heidelberg str. 76-0300 tRNA-Cys
    3227. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-1831 tRNA-Cys
    3228. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-2823 tRNA-Cys
    3229. Salmonella enterica subsp. enterica serovar Heidelberg str. 79-0480 tRNA-Cys
    3230. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-1617 tRNA-Cys
    3231. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-2052 tRNA-Cys
    3232. Salmonella enterica subsp. enterica serovar Heidelberg str. 83-1068 tRNA-Cys
    3233. Salmonella enterica subsp. enterica serovar Heidelberg str. 84-1004 tRNA-Cys
    3234. Salmonella enterica subsp. enterica serovar Heidelberg str. 85-0486 tRNA-Cys
    3235. Salmonella enterica subsp. enterica serovar Heidelberg str. 86-0255 tRNA-Cys
    3236. Salmonella enterica subsp. enterica serovar Heidelberg str. 87-0208 tRNA-Cys
    3237. Salmonella enterica subsp. enterica serovar Heidelberg str. 88-0312 tRNA-Cys
    3238. Salmonella enterica subsp. enterica serovar Heidelberg str. 89-0213 tRNA-Cys
    3239. Salmonella enterica subsp. enterica serovar Heidelberg str. 90-0318 tRNA-Cys
    3240. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0138 tRNA-Cys
    3241. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0144 tRNA-Cys
    3242. Salmonella enterica subsp. enterica serovar Heidelberg str. B182 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3243. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000577 tRNA-Cys
    3244. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000578 tRNA-Cys
    3245. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN001902 tRNA-Cys
    3246. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN001914 tRNA-Cys
    3247. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002056 tRNA-Cys
    3248. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002057 tRNA-Cys
    3249. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002058 tRNA-Cys
    3250. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002059 tRNA-Cys
    3251. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002060 tRNA-Cys
    3252. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002061 tRNA-Cys
    3253. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002062 tRNA-Cys
    3254. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002063 tRNA-Cys
    3255. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3256. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002065 tRNA-Cys
    3257. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002066 tRNA-Cys
    3258. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002067 tRNA-Cys
    3259. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002068 tRNA-Cys
    3260. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3261. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002071 tRNA-Cys
    3262. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002072 tRNA-Cys
    3263. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002073 tRNA-Cys
    3264. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002074 tRNA-Cys
    3265. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002075 tRNA-Cys
    3266. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00322 tRNA-Cys
    3267. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00323 tRNA-Cys
    3268. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00324 tRNA-Cys
    3269. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00325 tRNA-Cys
    3270. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00326 tRNA-Cys
    3271. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00327 tRNA-Cys
    3272. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00328 tRNA-Cys
    3273. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003485 tRNA-Cys
    3274. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM20752 tRNA-Cys
    3275. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24359 tRNA-Cys
    3276. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24388 tRNA-Cys
    3277. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24391 tRNA-Cys
    3278. Salmonella enterica subsp. enterica serovar Heidelberg str. N1514 tRNA-Cys
    3279. Salmonella enterica subsp. enterica serovar Heidelberg str. N1536 tRNA-Cys
    3280. Salmonella enterica subsp. enterica serovar Heidelberg str. N15757 tRNA-Cys
    3281. Salmonella enterica subsp. enterica serovar Heidelberg str. N18393 tRNA-Cys
    3282. Salmonella enterica subsp. enterica serovar Heidelberg str. N18413 tRNA-Cys
    3283. Salmonella enterica subsp. enterica serovar Heidelberg str. N18440 tRNA-Cys
    3284. Salmonella enterica subsp. enterica serovar Heidelberg str. N18453 tRNA-Cys
    3285. Salmonella enterica subsp. enterica serovar Heidelberg str. N189 tRNA-Cys
    3286. Salmonella enterica subsp. enterica serovar Heidelberg str. N19871 tRNA-Cys
    3287. Salmonella enterica subsp. enterica serovar Heidelberg str. N19992 tRNA-Cys
    3288. Salmonella enterica subsp. enterica serovar Heidelberg str. N20134 tRNA-Cys
    3289. Salmonella enterica subsp. enterica serovar Heidelberg str. N26457 tRNA-Cys
    3290. Salmonella enterica subsp. enterica serovar Heidelberg str. N29341 tRNA-Cys
    3291. Salmonella enterica subsp. enterica serovar Heidelberg str. N30678 tRNA-Cys
    3292. Salmonella enterica subsp. enterica serovar Heidelberg str. N418 tRNA-Cys
    3293. Salmonella enterica subsp. enterica serovar Heidelberg str. N4403 tRNA-Cys
    3294. Salmonella enterica subsp. enterica serovar Heidelberg str. N4496 tRNA-Cys
    3295. Salmonella enterica subsp. enterica serovar Heidelberg str. N4541 tRNA-Cys
    3296. Salmonella enterica subsp. enterica serovar Heidelberg str. N4630 tRNA-Cys
    3297. Salmonella enterica subsp. enterica serovar Heidelberg str. N653 tRNA-Cys
    3298. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013193 tRNA-Cys
    3299. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013312 tRNA-Cys
    3300. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013343 tRNA-Cys
    3301. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013374 tRNA-Cys
    3302. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013988 tRNA-Cys
    3303. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014316 tRNA-Cys
    3304. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014319 tRNA-Cys
    3305. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014588 tRNA-Cys
    3306. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA31 tRNA-Cys
    3307. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA32 tRNA-Cys
    3308. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA33 tRNA-Cys
    3309. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 tRNA-Cys
    3310. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA36 tRNA-Cys
    3311. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA37 tRNA-Cys
    3312. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA 39 tRNA-Cys
    3313. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA40 tRNA-Cys
    3314. Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3315. Salmonella enterica subsp. enterica serovar Heidelberg tRNA-Cys(gca)
    3316. Salmonella enterica subsp. enterica serovar Herston tRNA-Cys
    3317. Salmonella enterica subsp. enterica serovar Hessarek tRNA-Cys
    3318. Salmonella enterica subsp. enterica serovar Hillingdon str. N1529-D3 tRNA-Cys
    3319. Salmonella enterica subsp. enterica serovar Hillingdon tRNA-Cys
    3320. Salmonella enterica subsp. enterica serovar Hindmarsh tRNA-Cys
    3321. Salmonella enterica subsp. enterica serovar Hissar tRNA-Cys
    3322. Salmonella enterica subsp. enterica serovar Holcomb tRNA-Cys
    3323. Salmonella enterica subsp. enterica serovar Houston tRNA-Cys
    3324. Salmonella enterica subsp. enterica serovar Hull tRNA-Cys
    3325. Salmonella enterica subsp. enterica serovar Hvittingfoss str. A4-620 tRNA-Cys
    3326. Salmonella enterica subsp. enterica serovar Hvittingfoss str. SA20014981 tRNA-Cys
    3327. Salmonella enterica subsp. enterica serovar Hvittingfoss tRNA-Cys
    3328. Salmonella enterica subsp. enterica serovar Ibadan tRNA-Cys
    3329. Salmonella enterica subsp. enterica serovar Idikan tRNA-Cys
    3330. Salmonella enterica subsp. enterica serovar Ilala tRNA-Cys
    3331. Salmonella enterica subsp. enterica serovar Indiana str. ATCC 51959 tRNA-Cys
    3332. Salmonella enterica subsp. enterica serovar Indiana tRNA-Cys
    3333. Salmonella enterica subsp. enterica serovar India str. SA20085604 tRNA-Cys
    3334. Salmonella enterica subsp. enterica serovar Infantis str. 119944 tRNA-Cys
    3335. Salmonella enterica subsp. enterica serovar Infantis str. 335-3 tRNA-Cys
    3336. Salmonella enterica subsp. enterica serovar Infantis str. CFSAN000522 tRNA-Cys
    3337. Salmonella enterica subsp. enterica serovar Infantis str. CVM 17958 tRNA-Cys
    3338. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22577 tRNA-Cys
    3339. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22582 tRNA-Cys
    3340. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23697 tRNA-Cys
    3341. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23729 tRNA-Cys
    3342. Salmonella enterica subsp. enterica serovar Infantis str. CVM 818 tRNA-Cys
    3343. Salmonella enterica subsp. enterica serovar Infantis str. CVM N13139 tRNA-Cys
    3344. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15228 tRNA-Cys
    3345. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15773 tRNA-Cys
    3346. Salmonella enterica subsp. enterica serovar Infantis str. CVM N19983 tRNA-Cys
    3347. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20078 tRNA-Cys
    3348. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20272 tRNA-Cys
    3349. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23532 tRNA-Cys
    3350. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23771 tRNA-Cys
    3351. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23791 tRNA-Cys
    3352. Salmonella enterica subsp. enterica serovar Infantis str. CVM N26093 tRNA-Cys
    3353. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29304 tRNA-Cys
    3354. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29379 tRNA-Cys
    3355. Salmonella enterica subsp. enterica serovar Infantis str. CVM N31594 tRNA-Cys
    3356. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32590PS tRNA-Cys
    3357. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32597PS tRNA-Cys
    3358. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32599PS tRNA-Cys
    3359. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32760 tRNA-Cys
    3360. Salmonella enterica subsp. enterica serovar Infantis str. CVM N34868PS tRNA-Cys
    3361. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35495PS tRNA-Cys
    3362. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35518 tRNA-Cys
    3363. Salmonella enterica subsp. enterica serovar Infantis str. CVM N38848 tRNA-Cys
    3364. Salmonella enterica subsp. enterica serovar Infantis str. CVM N41903 tRNA-Cys
    3365. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42236 tRNA-Cys
    3366. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42459 tRNA-Cys
    3367. Salmonella enterica subsp. enterica serovar Infantis str. SARB27 tRNA-Cys
    3368. Salmonella enterica subsp. enterica serovar Infantis tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3369. Salmonella enterica subsp. enterica serovar Inganda tRNA-Cys
    3370. Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 tRNA-Cys
    3371. Salmonella enterica subsp. enterica serovar Inverness str. R8-3668 tRNA-Cys
    3372. Salmonella enterica subsp. enterica serovar Inverness tRNA-Cys
    3373. Salmonella enterica subsp. enterica serovar Irumu tRNA-Cys
    3374. Salmonella enterica subsp. enterica serovar Isangi tRNA-Cys
    3375. Salmonella enterica subsp. enterica serovar Itami str. SA20014991 tRNA-Cys
    3376. Salmonella enterica subsp. enterica serovar Itami tRNA-Cys
    3377. Salmonella enterica subsp. enterica serovar Ituri tRNA-Cys
    3378. Salmonella enterica subsp. enterica serovar Java tRNA-Cys(gca)
    3379. Salmonella enterica subsp. enterica serovar Javiana str. 10721 tRNA-Cys
    3380. Salmonella enterica subsp. enterica serovar Javiana str. ATCC BAA-1593 tRNA-Cys
    3381. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000904 tRNA-Cys
    3382. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000905 tRNA-Cys
    3383. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN001992 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3384. Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433 tRNA-Cys
    3385. Salmonella enterica subsp. enterica serovar Javiana str. PRS_2010_0720 tRNA-Cys
    3386. Salmonella enterica subsp. enterica serovar Javiana tRNA-Cys
    3387. Salmonella enterica subsp. enterica serovar Jerusalem tRNA-Cys
    3388. Salmonella enterica subsp. enterica serovar Joal tRNA-Cys
    3389. Salmonella enterica subsp. enterica serovar Jodhpur tRNA-Cys
    3390. Salmonella enterica subsp. enterica serovar Johannesburg str. S5-703 tRNA-Cys
    3391. Salmonella enterica subsp. enterica serovar Johannesburg str. SA20025782 tRNA-Cys
    3392. Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 tRNA-Cys
    3393. Salmonella enterica subsp. enterica serovar Johannesburg tRNA-Cys
    3394. Salmonella enterica subsp. enterica serovar Jubilee tRNA-Cys
    3395. Salmonella enterica subsp. enterica serovar Jukestown tRNA-Cys
    3396. Salmonella enterica subsp. enterica serovar Kallo tRNA-Cys
    3397. Salmonella enterica subsp. enterica serovar Kambole tRNA-Cys
    3398. Salmonella enterica subsp. enterica serovar Kande tRNA-Cys
    3399. Salmonella enterica subsp. enterica serovar Kandla tRNA-Cys
    3400. Salmonella enterica subsp. enterica serovar Kaolack tRNA-Cys
    3401. Salmonella enterica subsp. enterica serovar Kapemba tRNA-Cys
    3402. Salmonella enterica subsp. enterica serovar Karamoja tRNA-Cys
    3403. Salmonella enterica subsp. enterica serovar Kasenyi tRNA-Cys
    3404. Salmonella enterica subsp. enterica serovar Kastrup tRNA-Cys
    3405. Salmonella enterica subsp. enterica serovar Kedougou tRNA-Cys
    3406. Salmonella enterica subsp. enterica serovar Kentucky str. 0253 tRNA-Cys
    3407. Salmonella enterica subsp. enterica serovar Kentucky str. 13562 tRNA-Cys
    3408. Salmonella enterica subsp. enterica serovar Kentucky str. 20793 tRNA-Cys
    3409. Salmonella enterica subsp. enterica serovar Kentucky str. 22694 tRNA-Cys
    3410. Salmonella enterica subsp. enterica serovar Kentucky str. 29166 tRNA-Cys
    3411. Salmonella enterica subsp. enterica serovar Kentucky str. 29439 tRNA-Cys
    3412. Salmonella enterica subsp. enterica serovar Kentucky str. 5349 tRNA-Cys
    3413. Salmonella enterica subsp. enterica serovar Kentucky str. ATCC 9263 tRNA-Cys
    3414. Salmonella enterica subsp. enterica serovar Kentucky str. CVM29188 tRNA-Cys
    3415. Salmonella enterica subsp. enterica serovar Kentucky str. N312 tRNA-Cys
    3416. Salmonella enterica subsp. enterica serovar Kentucky str. SA20030505 tRNA-Cys
    3417. Salmonella enterica subsp. enterica serovar Kentucky tRNA-Cys
    3418. Salmonella enterica subsp. enterica serovar Kenya tRNA-Cys
    3419. Salmonella enterica subsp. enterica serovar Kiambu tRNA-Cys
    3420. Salmonella enterica subsp. enterica serovar Kibi tRNA-Cys
    3421. Salmonella enterica subsp. enterica serovar Kibusi tRNA-Cys
    3422. Salmonella enterica subsp. enterica serovar Kimberley tRNA-Cys
    3423. Salmonella enterica subsp. enterica serovar Kimuenza tRNA-Cys
    3424. Salmonella enterica subsp. enterica serovar Kingabwa tRNA-Cys
    3425. Salmonella enterica subsp. enterica serovar Kingston tRNA-Cys
    3426. Salmonella enterica subsp. enterica serovar Kinondoni tRNA-Cys
    3427. Salmonella enterica subsp. enterica serovar Kinshasa tRNA-Cys
    3428. Salmonella enterica subsp. enterica serovar Kintambo tRNA-Cys
    3429. Salmonella enterica subsp. enterica serovar Kirkee tRNA-Cys
    3430. Salmonella enterica subsp. enterica serovar Kisangani tRNA-Cys
    3431. Salmonella enterica subsp. enterica serovar Kisarawe tRNA-Cys
    3432. Salmonella enterica subsp. enterica serovar Kisii tRNA-Cys
    3433. Salmonella enterica subsp. enterica serovar Koessen str. S-1501 tRNA-Cys
    3434. Salmonella enterica subsp. enterica serovar Koketime tRNA-Cys
    3435. Salmonella enterica subsp. enterica serovar Kokomlemle tRNA-Cys
    3436. Salmonella enterica subsp. enterica serovar Korlebu tRNA-Cys
    3437. Salmonella enterica subsp. enterica serovar Kottbus tRNA-Cys
    3438. Salmonella enterica subsp. enterica serovar Kouka tRNA-Cys
    3439. Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 tRNA-Cys
    3440. Salmonella enterica subsp. enterica serovar Krefeld tRNA-Cys
    3441. Salmonella enterica subsp. enterica serovar Kuessel tRNA-Cys
    3442. Salmonella enterica subsp. enterica serovar Kumasi tRNA-Cys
    3443. Salmonella enterica subsp. enterica serovar Kunzendorf tRNA-Cys
    3444. Salmonella enterica subsp. enterica serovar Lagos tRNA-Cys
    3445. Salmonella enterica subsp. enterica serovar Lansing tRNA-Cys
    3446. Salmonella enterica subsp. enterica serovar Larochelle tRNA-Cys
    3447. Salmonella enterica subsp. enterica serovar Lattenkamp tRNA-Cys
    3448. Salmonella enterica subsp. enterica serovar Lawndale tRNA-Cys
    3449. Salmonella enterica subsp. enterica serovar Leatherhead tRNA-Cys
    3450. Salmonella enterica subsp. enterica serovar Leeuwarden tRNA-Cys
    3451. Salmonella enterica subsp. enterica serovar Legon tRNA-Cys
    3452. Salmonella enterica subsp. enterica serovar Leoben tRNA-Cys
    3453. Salmonella enterica subsp. enterica serovar Lerum tRNA-Cys
    3454. Salmonella enterica subsp. enterica serovar Lexington tRNA-Cys
    3455. Salmonella enterica subsp. enterica serovar Lika tRNA-Cys
    3456. Salmonella enterica subsp. enterica serovar Lille tRNA-Cys
    3457. Salmonella enterica subsp. enterica serovar Limete tRNA-Cys
    3458. Salmonella enterica subsp. enterica serovar Lindern tRNA-Cys
    3459. Salmonella enterica subsp. enterica serovar Linton tRNA-Cys
    3460. Salmonella enterica subsp. enterica serovar Litchfield str. CFSAN001076 tRNA-Cys
    3461. Salmonella enterica subsp. enterica serovar Litchfield tRNA-Cys
    3462. Salmonella enterica subsp. enterica serovar Liverpool tRNA-Cys
    3463. Salmonella enterica subsp. enterica serovar Livingstone tRNA-Cys
    3464. Salmonella enterica subsp. enterica serovar Llandoff tRNA-Cys
    3465. Salmonella enterica subsp. enterica serovar Loanda tRNA-Cys
    3466. Salmonella enterica subsp. enterica serovar Lomalinda tRNA-Cys
    3467. Salmonella enterica subsp. enterica serovar Lome tRNA-Cys
    3468. Salmonella enterica subsp. enterica serovar London str. CFSAN001081 tRNA-Cys
    3469. Salmonella enterica subsp. enterica serovar London tRNA-Cys
    3470. Salmonella enterica subsp. enterica serovar Louisiana tRNA-Cys
    3471. Salmonella enterica subsp. enterica serovar Lubbock tRNA-Cys
    3472. Salmonella enterica subsp. enterica serovar Luciana tRNA-Cys
    3473. Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 tRNA-Cys
    3474. Salmonella enterica subsp. enterica serovar Madelia tRNA-Cys(gca)
    3475. Salmonella enterica subsp. enterica serovar Malaysia tRNA-Cys
    3476. Salmonella enterica subsp. enterica serovar Malstatt tRNA-Cys
    3477. Salmonella enterica subsp. enterica serovar Manchester str. ST278 tRNA-Cys
    3478. Salmonella enterica subsp. enterica serovar Manchester tRNA-Cys
    3479. Salmonella enterica subsp. enterica serovar Manhattan str. 111113 tRNA-Cys-GCA
    3480. Salmonella enterica subsp. enterica serovar Manhattan str. CFSAN001078 tRNA-Cys
    3481. Salmonella enterica subsp. enterica serovar Manhattan str. SA20034532 tRNA-Cys
    3482. Salmonella enterica subsp. enterica serovar Manhattan tRNA-Cys
    3483. Salmonella enterica subsp. enterica serovar Mapo tRNA-Cys
    3484. Salmonella enterica subsp. enterica serovar Matadi tRNA-Cys
    3485. Salmonella enterica subsp. enterica serovar Matopeni tRNA-Cys
    3486. Salmonella enterica subsp. enterica serovar Mbandaka str. ATCC 51958 tRNA-Cys
    3487. Salmonella enterica subsp. enterica serovar Mbandaka tRNA-Cys
    3488. Salmonella enterica subsp. enterica serovar Meleagridis str. 0047 tRNA-Cys
    3489. Salmonella enterica subsp. enterica serovar Meleagridis tRNA-Cys
    3490. Salmonella enterica subsp. enterica serovar Mendoza tRNA-Cys
    3491. Salmonella enterica subsp. enterica serovar Menston tRNA-Cys
    3492. Salmonella enterica subsp. enterica serovar Mesbit tRNA-Cys
    3493. Salmonella enterica subsp. enterica serovar Mgulani tRNA-Cys
    3494. Salmonella enterica subsp. enterica serovar Miami str. 1923 tRNA-Cys
    3495. Salmonella enterica subsp. enterica serovar Miami str. CFSAN000579 tRNA-Cys
    3496. Salmonella enterica subsp. enterica serovar Miami tRNA-Cys
    3497. Salmonella enterica subsp. enterica serovar Michigan tRNA-Cys
    3498. Salmonella enterica subsp. enterica serovar Middlesbrough tRNA-Cys
    3499. Salmonella enterica subsp. enterica serovar Mikawasima tRNA-Cys
    3500. Salmonella enterica subsp. enterica serovar Millesi tRNA-Cys
    3501. Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 tRNA-Cys
    3502. Salmonella enterica subsp. enterica serovar Minneapolis tRNA-Cys
    3503. Salmonella enterica subsp. enterica serovar Minnesota str. A4-603 tRNA-Cys
    3504. Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 tRNA-Cys
    3505. Salmonella enterica subsp. enterica serovar Minnesota tRNA-Cys
    3506. Salmonella enterica subsp. enterica serovar Mishmarhaemek tRNA-Cys
    3507. Salmonella enterica subsp. enterica serovar Mississippi str. A4-633 tRNA-Cys
    3508. Salmonella enterica subsp. enterica serovar Mississippi tRNA-Cys
    3509. Salmonella enterica subsp. enterica serovar Moero tRNA-Cys
    3510. Salmonella enterica subsp. enterica serovar Mokola tRNA-Cys
    3511. Salmonella enterica subsp. enterica serovar Molade tRNA-Cys
    3512. Salmonella enterica subsp. enterica serovar Monophasic tRNA-Cys
    3513. Salmonella enterica subsp. enterica serovar Monschaui tRNA-Cys
    3514. Salmonella enterica subsp. enterica serovar Montevideo str. 19N tRNA-Cys
    3515. Salmonella enterica subsp. enterica serovar Montevideo str. 2009083312 tRNA-Cys
    3516. Salmonella enterica subsp. enterica serovar Montevideo str. 2009085258 tRNA-Cys
    3517. Salmonella enterica subsp. enterica serovar Montevideo str. 29N tRNA-Cys
    3518. Salmonella enterica subsp. enterica serovar Montevideo str. 315731156 tRNA-Cys
    3519. Salmonella enterica subsp. enterica serovar Montevideo str. 315996572 tRNA-Cys
    3520. Salmonella enterica subsp. enterica serovar Montevideo str. 316111868 tRNA-Cys
    3521. Salmonella enterica subsp. enterica serovar Montevideo str. 366867 tRNA-Cys
    3522. Salmonella enterica subsp. enterica serovar Montevideo str. 413180 tRNA-Cys
    3523. Salmonella enterica subsp. enterica serovar Montevideo str. 414877 tRNA-Cys
    3524. Salmonella enterica subsp. enterica serovar Montevideo str. 42N tRNA-Cys
    3525. Salmonella enterica subsp. enterica serovar Montevideo str. 4441 H tRNA-Cys
    3526. Salmonella enterica subsp. enterica serovar Montevideo str. 446600 tRNA-Cys
    3527. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-1 tRNA-Cys
    3528. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-3 tRNA-Cys
    3529. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-4 tRNA-Cys
    3530. Salmonella enterica subsp. enterica serovar Montevideo str. 507440-20 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3531. Salmonella enterica subsp. enterica serovar Montevideo str. 515920-1 tRNA-Cys
    3532. Salmonella enterica subsp. enterica serovar Montevideo str. 515920-2 tRNA-Cys
    3533. Salmonella enterica subsp. enterica serovar Montevideo str. 531954 tRNA-Cys
    3534. Salmonella enterica subsp. enterica serovar Montevideo str. 556150-1 tRNA-Cys
    3535. Salmonella enterica subsp. enterica serovar Montevideo str. 556152 tRNA-Cys
    3536. Salmonella enterica subsp. enterica serovar Montevideo str. 609458-1 tRNA-Cys
    3537. Salmonella enterica subsp. enterica serovar Montevideo str. 609458-2 tRNA-Cys
    3538. Salmonella enterica subsp. enterica serovar Montevideo str. 609460 tRNA-Cys
    3539. Salmonella enterica subsp. enterica serovar Montevideo str. 644129 tRNA-Cys
    3540. Salmonella enterica subsp. enterica serovar Montevideo str. 80959-06 tRNA-Cys
    3541. Salmonella enterica subsp. enterica serovar Montevideo str. 81038-01 tRNA-Cys
    3542. Salmonella enterica subsp. enterica serovar Montevideo str. 8387 tRNA-Cys
    3543. Salmonella enterica subsp. enterica serovar Montevideo str. ATCC BAA710 tRNA-Cys
    3544. Salmonella enterica subsp. enterica serovar Montevideo str. CASC_09SCPH15965 tRNA-Cys
    3545. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 07-0954 tRNA-Cys
    3546. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 08-1942 tRNA-Cys
    3547. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 tRNA-Cys
    3548. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 tRNA-Cys
    3549. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2011K-1674 tRNA-Cys
    3550. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2012K-1544 tRNA-Cys
    3551. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2013K-0218 tRNA-Cys
    3552. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 86-0391 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3553. Salmonella enterica subsp. enterica serovar Montevideo str. CFSAN004346 tRNA-Cys
    3554. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035278 tRNA-Cys
    3555. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035318 tRNA-Cys
    3556. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035320 tRNA-Cys
    3557. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035321 tRNA-Cys
    3558. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035327 tRNA-Cys
    3559. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-2868 tRNA-Cys
    3560. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4673 tRNA-Cys
    3561. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4843 tRNA-Cys
    3562. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4916 tRNA-Cys
    3563. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4922 tRNA-Cys
    3564. Salmonella enterica subsp. enterica serovar Montevideo str. FVM_628064 tRNA-Cys
    3565. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2009159199 tRNA-Cys
    3566. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008282 tRNA-Cys
    3567. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008283 tRNA-Cys
    3568. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008284 tRNA-Cys
    3569. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008285 tRNA-Cys
    3570. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008286 tRNA-Cys
    3571. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008287 tRNA-Cys
    3572. Salmonella enterica subsp. enterica serovar Montevideo str. LQC 10 tRNA-Cys
    3573. Salmonella enterica subsp. enterica serovar Montevideo str. MB101509-0077 tRNA-Cys
    3574. Salmonella enterica subsp. enterica serovar Montevideo str. MB102109-0047 tRNA-Cys
    3575. Salmonella enterica subsp. enterica serovar Montevideo str. MB110209-0055 tRNA-Cys
    3576. Salmonella enterica subsp. enterica serovar Montevideo str. MB111609-0052 tRNA-Cys
    3577. Salmonella enterica subsp. enterica serovar Montevideo str. MD_MDA09249507 tRNA-Cys
    3578. Salmonella enterica subsp. enterica serovar Montevideo str. N19965 tRNA-Cys
    3579. Salmonella enterica subsp. enterica serovar Montevideo str. NC_MB110209-0054 tRNA-Cys
    3580. Salmonella enterica subsp. enterica serovar Montevideo str. OH_2009072675 tRNA-Cys
    3581. Salmonella enterica subsp. enterica serovar Montevideo str. S5-403 tRNA-Cys
    3582. Salmonella enterica subsp. enterica serovar Montevideo str. SARB30 tRNA-Cys
    3583. Salmonella enterica subsp. enterica serovar Montevideo str. SARB31 tRNA-Cys
    3584. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1900 tRNA-Cys
    3585. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1901 tRNA-Cys
    3586. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1903 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3587. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1904 tRNA-Cys
    3588. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1912 tRNA-Cys
    3589. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 tRNA-Cys
    3590. Salmonella enterica subsp. enterica serovar Montevideo tRNA-Cys(gca)
    3591. Salmonella enterica subsp. enterica serovar Morehead tRNA-Cys
    3592. Salmonella enterica subsp. enterica serovar Moroto tRNA-Cys
    3593. Salmonella enterica subsp. enterica serovar Moscow str. S-1843 tRNA-Cys
    3594. Salmonella enterica subsp. enterica serovar Moscow str. SA20061414 tRNA-Cys
    3595. Salmonella enterica subsp. enterica serovar Moscow tRNA-Cys
    3596. Salmonella enterica subsp. enterica serovar Mountpleasant tRNA-Cys
    3597. Salmonella enterica subsp. enterica serovar Muenchen str. ATCC 8388 tRNA-Cys
    3598. Salmonella enterica subsp. enterica serovar Muenchen str. baa1594 tRNA-Cys
    3599. Salmonella enterica subsp. enterica serovar Muenchen str. baa1674 tRNA-Cys
    3600. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000585 tRNA-Cys
    3601. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000591 tRNA-Cys
    3602. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000593 tRNA-Cys
    3603. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000595 tRNA-Cys
    3604. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000596 tRNA-Cys
    3605. Salmonella enterica subsp. enterica serovar Muenchen str. RKS4129 tRNA-Cys
    3606. Salmonella enterica subsp. enterica serovar Muenchen tRNA-Cys
    3607. Salmonella enterica subsp. enterica serovar Muenster str. 0315 tRNA-Cys
    3608. Salmonella enterica subsp. enterica serovar Muenster str. 420 tRNA-Cys
    3609. Salmonella enterica subsp. enterica serovar Muenster str. 660 tRNA-Cys
    3610. Salmonella enterica subsp. enterica serovar Muenster str. CFSAN004344 tRNA-Cys
    3611. Salmonella enterica subsp. enterica serovar Muenster tRNA-Cys
    3612. Salmonella enterica subsp. enterica serovar Nagoya tRNA-Cys
    3613. Salmonella enterica subsp. enterica serovar Namur str. 05-2929 tRNA-Cys
    3614. Salmonella enterica subsp. enterica serovar Napoli tRNA-Cys
    3615. Salmonella enterica subsp. enterica serovar Nchanga str. CFSAN001091 tRNA-Cys
    3616. Salmonella enterica subsp. enterica serovar Nchanga str. CFSAN001092 tRNA-Cys
    3617. Salmonella enterica subsp. enterica serovar Nchanga tRNA-Cys
    3618. Salmonella enterica subsp. enterica serovar Ndolo tRNA-Cys
    3619. Salmonella enterica subsp. enterica serovar Neukoelln tRNA-Cys
    3620. Salmonella enterica subsp. enterica serovar Neunkirchen tRNA-Cys
    3621. Salmonella enterica subsp. enterica serovar Newington tRNA-Cys
    3622. Salmonella enterica subsp. enterica serovar Newmexico tRNA-Cys
    3623. Salmonella enterica subsp. enterica serovar Newport str. #11-2 tRNA-Cys
    3624. Salmonella enterica subsp. enterica serovar Newport str. #11-3 tRNA-Cys
    3625. Salmonella enterica subsp. enterica serovar Newport str. #11-4 tRNA-Cys
    3626. Salmonella enterica subsp. enterica serovar Newport str. 36799 tRNA-Cys
    3627. Salmonella enterica subsp. enterica serovar Newport str. 36801 tRNA-Cys
    3628. Salmonella enterica subsp. enterica serovar Newport str. 36802 tRNA-Cys
    3629. Salmonella enterica subsp. enterica serovar Newport str. 36803 tRNA-Cys
    3630. Salmonella enterica subsp. enterica serovar Newport str. 36804 tRNA-Cys
    3631. Salmonella enterica subsp. enterica serovar Newport str. 36805 tRNA-Cys
    3632. Salmonella enterica subsp. enterica serovar Newport str. 36807 tRNA-Cys
    3633. Salmonella enterica subsp. enterica serovar Newport str. 637564_17 tRNA-Cys
    3634. Salmonella enterica subsp. enterica serovar Newport str. A182RVB tRNA-Cys
    3635. Salmonella enterica subsp. enterica serovar Newport str. A-211-RVH tRNA-Cys
    3636. Salmonella enterica subsp. enterica serovar Newport str. CDC 2009K-1331 tRNA-Cys
    3637. Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3638. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 tRNA-Cys
    3639. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 tRNA-Cys
    3640. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000597 tRNA-Cys
    3641. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000598 tRNA-Cys
    3642. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000599 tRNA-Cys
    3643. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000826 tRNA-Cys
    3644. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000827 tRNA-Cys
    3645. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000828 tRNA-Cys
    3646. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000829 tRNA-Cys
    3647. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000830 tRNA-Cys
    3648. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000831 tRNA-Cys
    3649. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000832 tRNA-Cys
    3650. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000833 tRNA-Cys
    3651. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000834 tRNA-Cys
    3652. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000835 tRNA-Cys
    3653. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000837 tRNA-Cys
    3654. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000901 tRNA-Cys
    3655. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001889 tRNA-Cys
    3656. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001890 tRNA-Cys
    3657. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001894 tRNA-Cys
    3658. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001895 tRNA-Cys
    3659. Salmonella enterica subsp. enterica serovar Newport str. CVM17619 tRNA-Cys
    3660. Salmonella enterica subsp. enterica serovar Newport str. CVM18000 tRNA-Cys
    3661. Salmonella enterica subsp. enterica serovar Newport str. CVM18005 tRNA-Cys
    3662. Salmonella enterica subsp. enterica serovar Newport str. CVM 19443 tRNA-Cys
    3663. Salmonella enterica subsp. enterica serovar Newport str. CVM 19447 tRNA-Cys
    3664. Salmonella enterica subsp. enterica serovar Newport str. CVM 19449 tRNA-Cys
    3665. Salmonella enterica subsp. enterica serovar Newport str. CVM 19470 tRNA-Cys
    3666. Salmonella enterica subsp. enterica serovar Newport str. CVM 19536 tRNA-Cys
    3667. Salmonella enterica subsp. enterica serovar Newport str. CVM 19567 tRNA-Cys
    3668. Salmonella enterica subsp. enterica serovar Newport str. CVM 19593 tRNA-Cys
    3669. Salmonella enterica subsp. enterica serovar Newport str. CVM20775 tRNA-Cys
    3670. Salmonella enterica subsp. enterica serovar Newport str. CVM20776 tRNA-Cys
    3671. Salmonella enterica subsp. enterica serovar Newport str. CVM21537 tRNA-Cys
    3672. Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3673. Salmonella enterica subsp. enterica serovar Newport str. CVM 21539 tRNA-Cys
    3674. Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3675. Salmonella enterica subsp. enterica serovar Newport str. CVM 21554 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3676. Salmonella enterica subsp. enterica serovar Newport str. CVM 21559 tRNA-Cys
    3677. Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3678. Salmonella enterica subsp. enterica serovar Newport str. CVM22443 tRNA-Cys
    3679. Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3680. Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3681. Salmonella enterica subsp. enterica serovar Newport str. CVM22697 tRNA-Cys
    3682. Salmonella enterica subsp. enterica serovar Newport str. CVM22699 tRNA-Cys
    3683. Salmonella enterica subsp. enterica serovar Newport str. CVM22707 tRNA-Cys
    3684. Salmonella enterica subsp. enterica serovar Newport str. CVM24403 tRNA-Cys
    3685. Salmonella enterica subsp. enterica serovar Newport str. CVM30171 tRNA-Cys
    3686. Salmonella enterica subsp. enterica serovar Newport str. CVM 33953 tRNA-Cys
    3687. Salmonella enterica subsp. enterica serovar Newport str. CVM34519 tRNA-Cys
    3688. Salmonella enterica subsp. enterica serovar Newport str. CVM 35185 tRNA-Cys
    3689. Salmonella enterica subsp. enterica serovar Newport str. CVM 35188 tRNA-Cys
    3690. Salmonella enterica subsp. enterica serovar Newport str. CVM 35199 tRNA-Cys
    3691. Salmonella enterica subsp. enterica serovar Newport str. CVM 35202 tRNA-Cys
    3692. Salmonella enterica subsp. enterica serovar Newport str. CVM 37978 tRNA-Cys
    3693. Salmonella enterica subsp. enterica serovar Newport str. CVM 4176 tRNA-Cys
    3694. Salmonella enterica subsp. enterica serovar Newport str. CVM75_1280 tRNA-Cys
    3695. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1357 tRNA-Cys
    3696. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1594 tRNA-Cys
    3697. Salmonella enterica subsp. enterica serovar Newport str. CVM80_2288 tRNA-Cys
    3698. Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3699. Salmonella enterica subsp. enterica serovar Newport str. CVM N18486 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3700. Salmonella enterica subsp. enterica serovar Newport str. DC_10-446 tRNA-Cys
    3701. Salmonella enterica subsp. enterica serovar Newport str. DC_10-449 tRNA-Cys
    3702. Salmonella enterica subsp. enterica serovar Newport str. DC_10-450 tRNA-Cys
    3703. Salmonella enterica subsp. enterica serovar Newport str. Henan_3 tRNA-Cys
    3704. Salmonella enterica subsp. enterica serovar Newport str. JS09102 tRNA-Cys
    3705. Salmonella enterica subsp. enterica serovar Newport str. L0167 tRNA-Cys
    3706. Salmonella enterica subsp. enterica serovar Newport str. Levine 15 tRNA-Cys
    3707. Salmonella enterica subsp. enterica serovar Newport str. Levine 1 tRNA-Cys
    3708. Salmonella enterica subsp. enterica serovar Newport str. MA_10EN1469 tRNA-Cys
    3709. Salmonella enterica subsp. enterica serovar Newport str. Pond080-2TTA tRNA-Cys
    3710. Salmonella enterica subsp. enterica serovar Newport str. PRS_2010_0624 tRNA-Cys
    3711. Salmonella enterica subsp. enterica serovar Newport str. RI_10P068 tRNA-Cys
    3712. Salmonella enterica subsp. enterica serovar Newport str. RI_10P069 tRNA-Cys
    3713. Salmonella enterica subsp. enterica serovar Newport str. RI_10P078 tRNA-Cys
    3714. Salmonella enterica subsp. enterica serovar Newport str. RI_10P079 tRNA-Cys
    3715. Salmonella enterica subsp. enterica serovar Newport str. S09097 tRNA-Cys
    3716. Salmonella enterica subsp. enterica serovar Newport str. S103RVX tRNA-Cys
    3717. Salmonella enterica subsp. enterica serovar Newport str. SH111077 tRNA-Cys
    3718. Salmonella enterica subsp. enterica serovar Newport str. Shandong_3 tRNA-Cys
    3719. Salmonella enterica subsp. enterica serovar Newport str. SHSN001 tRNA-Cys
    3720. Salmonella enterica subsp. enterica serovar Newport str. SHSN002 tRNA-Cys
    3721. Salmonella enterica subsp. enterica serovar Newport str. SHSN003 tRNA-Cys
    3722. Salmonella enterica subsp. enterica serovar Newport str. SHSN004 tRNA-Cys
    3723. Salmonella enterica subsp. enterica serovar Newport str. SHSN005 tRNA-Cys
    3724. Salmonella enterica subsp. enterica serovar Newport str. SHSN006 tRNA-Cys
    3725. Salmonella enterica subsp. enterica serovar Newport str. SHSN007 tRNA-Cys
    3726. Salmonella enterica subsp. enterica serovar Newport str. SHSN008 tRNA-Cys
    3727. Salmonella enterica subsp. enterica serovar Newport str. SHSN009 tRNA-Cys
    3728. Salmonella enterica subsp. enterica serovar Newport str. SHSN010 tRNA-Cys
    3729. Salmonella enterica subsp. enterica serovar Newport str. SHSN011 tRNA-Cys
    3730. Salmonella enterica subsp. enterica serovar Newport str. SHSN012 tRNA-Cys
    3731. Salmonella enterica subsp. enterica serovar Newport str. SHSN013 tRNA-Cys
    3732. Salmonella enterica subsp. enterica serovar Newport str. SHSN014 tRNA-Cys
    3733. Salmonella enterica subsp. enterica serovar Newport str. SL254 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3734. Salmonella enterica subsp. enterica serovar Newport str. SL317 tRNA-Cys
    3735. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 tRNA-Cys
    3736. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 tRNA-Cys
    3737. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 tRNA-Cys
    3738. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 tRNA-Cys
    3739. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1927 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3740. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 tRNA-Cys
    3741. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 tRNA-Cys
    3742. Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3743. Salmonella enterica subsp. enterica serovar Newport str. VA_R100506907 tRNA-Cys
    3744. Salmonella enterica subsp. enterica serovar Newport str. VA_R100512570 tRNA-Cys
    3745. Salmonella enterica subsp. enterica serovar Newport str. VA_R100512572 tRNA-Cys
    3746. Salmonella enterica subsp. enterica serovar Newport str. VA_R100804798 tRNA-Cys
    3747. Salmonella enterica subsp. enterica serovar Newport str. VA_R100808502 tRNA-Cys
    3748. Salmonella enterica subsp. enterica serovar Newport str. WA_14881 tRNA-Cys
    3749. Salmonella enterica subsp. enterica serovar Newport str. WA_14882 tRNA-Cys
    3750. Salmonella enterica subsp. enterica serovar Newport str. WA_14885 tRNA-Cys
    3751. Salmonella enterica subsp. enterica serovar Newport str. WA_14900 tRNA-Cys
    3752. Salmonella enterica subsp. enterica serovar Newport tRNA-Cys
    3753. Salmonella enterica subsp. enterica serovar Ngili tRNA-Cys
    3754. Salmonella enterica subsp. enterica serovar Nigeria tRNA-Cys
    3755. Salmonella enterica subsp. enterica serovar Nima tRNA-Cys
    3756. Salmonella enterica subsp. enterica serovar Nitra tRNA-Cys
    3757. Salmonella enterica subsp. enterica serovar Norwich str. CFSAN001077 tRNA-Cys
    3758. Salmonella enterica subsp. enterica serovar Norwich tRNA-Cys
    3759. Salmonella enterica subsp. enterica serovar Nottingham tRNA-Cys
    3760. Salmonella enterica subsp. enterica serovar Noya tRNA-Cys
    3761. Salmonella enterica subsp. enterica serovar Oakland tRNA-Cys
    3762. Salmonella enterica subsp. enterica serovar Obogu tRNA-Cys
    3763. Salmonella enterica subsp. enterica serovar Odozi tRNA-Cys
    3764. Salmonella enterica subsp. enterica serovar Offa tRNA-Cys
    3765. Salmonella enterica subsp. enterica serovar Ohio str. CFSAN001079 tRNA-Cys
    3766. Salmonella enterica subsp. enterica serovar Ohio tRNA-Cys
    3767. Salmonella enterica subsp. enterica serovar Okatie tRNA-Cys
    3768. Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 tRNA-Cys
    3769. Salmonella enterica subsp. enterica serovar Onderstepoort tRNA-Cys
    3770. Salmonella enterica subsp. enterica serovar Onireke tRNA-Cys
    3771. Salmonella enterica subsp. enterica serovar Oranienburg str. 0250 tRNA-Cys
    3772. Salmonella enterica subsp. enterica serovar Oranienburg str. 701 tRNA-Cys
    3773. Salmonella enterica subsp. enterica serovar Oranienburg str. S-76 tRNA-Cys
    3774. Salmonella enterica subsp. enterica serovar Oranienburg tRNA-Cys(gca)
    3775. Salmonella enterica subsp. enterica serovar Ordonez tRNA-Cys
    3776. Salmonella enterica subsp. enterica serovar Orientalis tRNA-Cys
    3777. Salmonella enterica subsp. enterica serovar Orion tRNA-Cys
    3778. Salmonella enterica subsp. enterica serovar O rough tRNA-Cys
    3779. Salmonella enterica subsp. enterica serovar Oskarshamn tRNA-Cys
    3780. Salmonella enterica subsp. enterica serovar Oslo tRNA-Cys
    3781. Salmonella enterica subsp. enterica serovar Othmarschen tRNA-Cys
    3782. Salmonella enterica subsp. enterica serovar Ouagadougou tRNA-Cys
    3783. Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 tRNA-Cys
    3784. Salmonella enterica subsp. enterica serovar Ouakam tRNA-Cys
    3785. Salmonella enterica subsp. enterica serovar Oudwijk tRNA-Cys
    3786. Salmonella enterica subsp. enterica serovar Overschie tRNA-Cys
    3787. Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 tRNA-Cys
    3788. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000600 tRNA-Cys
    3789. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000601 tRNA-Cys
    3790. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000602 tRNA-Cys
    3791. Salmonella enterica subsp. enterica serovar Panama str. SA20030878 tRNA-Cys
    3792. Salmonella enterica subsp. enterica serovar Panama tRNA-Cys(gca)
    3793. Salmonella enterica subsp. enterica serovar Papuana tRNA-Cys
    3794. Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3795. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 tRNA-Cys
    3796. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3797. Salmonella enterica subsp. enterica serovar Paratyphi A str. SA19950809 tRNA-Cys
    3798. Salmonella enterica subsp. enterica serovar Paratyphi A tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3799. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 10719 tRNA-Cys
    3800. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 19940 tRNA-Cys
    3801. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 51962 tRNA-Cys
    3802. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 8759 tRNA-Cys
    3803. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC BAA-1585 tRNA-Cys
    3804. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000532 tRNA-Cys
    3805. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000540 tRNA-Cys
    3806. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000541 tRNA-Cys
    3807. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000542 tRNA-Cys
    3808. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000545 tRNA-Cys
    3809. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000547 tRNA-Cys
    3810. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000548 tRNA-Cys
    3811. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000549 tRNA-Cys
    3812. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA42 tRNA-Cys
    3813. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA56 tRNA-Cys
    3814. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA61 tRNA-Cys
    3815. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA62 tRNA-Cys
    3816. Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3817. Salmonella enterica subsp. enterica serovar Paratyphi B tRNA-Cys
    3818. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000603 tRNA-Cys
    3819. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000604 tRNA-Cys
    3820. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000605 tRNA-Cys
    3821. Salmonella enterica subsp. enterica serovar Paratyphi C str. RKS4594 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3822. Salmonella enterica subsp. enterica serovar Paratyphi C tRNA-Cys(gca)
    3823. Salmonella enterica subsp. enterica serovar Parkroyal tRNA-Cys
    3824. Salmonella enterica subsp. enterica serovar Pasing tRNA-Cys
    3825. Salmonella enterica subsp. enterica serovar Penarth tRNA-Cys
    3826. Salmonella enterica subsp. enterica serovar Pensacola tRNA-Cys
    3827. Salmonella enterica subsp. enterica serovar Plymouth tRNA-Cys
    3828. Salmonella enterica subsp. enterica serovar Poano tRNA-Cys
    3829. Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 tRNA-Cys
    3830. Salmonella enterica subsp. enterica serovar Pomona tRNA-Cys
    3831. Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 tRNA-Cys
    3832. Salmonella enterica subsp. enterica serovar Poona tRNA-Cys(gca)
    3833. Salmonella enterica subsp. enterica serovar Potsdam tRNA-Cys
    3834. Salmonella enterica subsp. enterica serovar Praha tRNA-Cys
    3835. Salmonella enterica subsp. enterica serovar Pretoria tRNA-Cys
    3836. Salmonella enterica subsp. enterica serovar Pullorum str. 13036 tRNA-Cys
    3837. Salmonella enterica subsp. enterica serovar Pullorum str. 19945 tRNA-Cys
    3838. Salmonella enterica subsp. enterica serovar Pullorum str. ATCC 9120 tRNA-Cys
    3839. Salmonella enterica subsp. enterica serovar Pullorum str. CFSAN000606 tRNA-Cys
    3840. Salmonella enterica subsp. enterica serovar Pullorum str. S06004 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3841. Salmonella enterica subsp. enterica serovar Pullorum tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3842. Salmonella enterica subsp. enterica serovar Putten tRNA-Cys
    3843. Salmonella enterica subsp. enterica serovar Quebec str. S-1267 tRNA-Cys
    3844. Salmonella enterica subsp. enterica serovar Ramatgan tRNA-Cys
    3845. Salmonella enterica subsp. enterica serovar Rauform tRNA-Cys
    3846. Salmonella enterica subsp. enterica serovar Reading tRNA-Cys
    3847. Salmonella enterica subsp. enterica serovar Redba tRNA-Cys
    3848. Salmonella enterica subsp. enterica serovar Redlands tRNA-Cys
    3849. Salmonella enterica subsp. enterica serovar Remiremont tRNA-Cys
    3850. Salmonella enterica subsp. enterica serovar Remo tRNA-Cys
    3851. Salmonella enterica subsp. enterica serovar Richmond tRNA-Cys
    3852. Salmonella enterica subsp. enterica serovar Rideau tRNA-Cys
    3853. Salmonella enterica subsp. enterica serovar Ridge tRNA-Cys
    3854. Salmonella enterica subsp. enterica serovar Rissen str. 150 tRNA-Cys
    3855. Salmonella enterica subsp. enterica serovar Rissen tRNA-Cys
    3856. Salmonella enterica subsp. enterica serovar Roodepoort tRNA-Cys
    3857. Salmonella enterica subsp. enterica serovar Rostock tRNA-Cys
    3858. Salmonella enterica subsp. enterica serovar Rottnest tRNA-Cys
    3859. Salmonella enterica subsp. enterica serovar Rough:b:1,2 tRNA-Cys
    3860. Salmonella enterica subsp. enterica serovar Rough O:d:1,7 tRNA-Cys
    3861. Salmonella enterica subsp. enterica serovar Rough O:-:- tRNA-Cys
    3862. Salmonella enterica subsp. enterica serovar Rovaniemi tRNA-Cys
    3863. Salmonella enterica subsp. enterica serovar Rubislaw str. A4-653 tRNA-Cys
    3864. Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 tRNA-Cys
    3865. Salmonella enterica subsp. enterica serovar Rubislaw str. SA20030553 tRNA-Cys
    3866. Salmonella enterica subsp. enterica serovar Rubislaw tRNA-Cys
    3867. Salmonella enterica subsp. enterica serovar Ruiru tRNA-Cys
    3868. Salmonella enterica subsp. enterica serovar Saarbruecken tRNA-Cys
    3869. Salmonella enterica subsp. enterica serovar Saintpaul str. 9712 tRNA-Cys
    3870. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000612 tRNA-Cys
    3871. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000618 tRNA-Cys
    3872. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000619 tRNA-Cys
    3873. Salmonella enterica subsp. enterica serovar Saintpaul str. JO2008 tRNA-Cys
    3874. Salmonella enterica subsp. enterica serovar Saintpaul str. S-70 tRNA-Cys
    3875. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA23 tRNA-Cys
    3876. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA26 tRNA-Cys
    3877. Salmonella enterica subsp. enterica serovar Saintpaul tRNA-Cys
    3878. Salmonella enterica subsp. enterica serovar Salford tRNA-Cys
    3879. Salmonella enterica subsp. enterica serovar Sandiego tRNA-Cys
    3880. Salmonella enterica subsp. enterica serovar Sanjuan tRNA-Cys(gca)
    3881. Salmonella enterica subsp. enterica serovar Saphra tRNA-Cys
    3882. Salmonella enterica subsp. enterica serovar Sarajane tRNA-Cys
    3883. Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3884. Salmonella enterica subsp. enterica serovar Schwarzengrund str. SL480 tRNA-Cys
    3885. Salmonella enterica subsp. enterica serovar Schwarzengrund tRNA-Cys
    3886. Salmonella enterica subsp. enterica serovar Seattle tRNA-Cys
    3887. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-Cys
    3888. Salmonella enterica subsp. enterica serovar Sekondi tRNA-Cys
    3889. Salmonella enterica subsp. enterica serovar Sendai str. CFSAN000621 tRNA-Cys
    3890. Salmonella enterica subsp. enterica serovar Sendai tRNA-Cys(gca)
    3891. Salmonella enterica subsp. enterica serovar Senegal tRNA-Cys
    3892. Salmonella enterica subsp. enterica serovar Senftenberg str. 316235162 tRNA-Cys
    3893. Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 tRNA-Cys
    3894. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-1 tRNA-Cys
    3895. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-2 tRNA-Cys
    3896. Salmonella enterica subsp. enterica serovar Senftenberg str. 604314 tRNA-Cys
    3897. Salmonella enterica subsp. enterica serovar Senftenberg str. A4-543 tRNA-Cys
    3898. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 tRNA-Cys
    3899. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 8400 tRNA-Cys
    3900. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 tRNA-Cys
    3901. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004030 tRNA-Cys
    3902. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004031 tRNA-Cys
    3903. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004032 tRNA-Cys
    3904. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004033 tRNA-Cys
    3905. Salmonella enterica subsp. enterica serovar Senftenberg str. NC_MB012510-0038 tRNA-Cys
    3906. Salmonella enterica subsp. enterica serovar Senftenberg str. SS209 transfer RNA-Cys
    3907. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-Cys(gca)
    3908. Salmonella enterica subsp. enterica serovar Senneville tRNA-Cys
    3909. Salmonella enterica subsp. enterica serovar Shamba tRNA-Cys
    3910. Salmonella enterica subsp. enterica serovar Shubra tRNA-Cys
    3911. Salmonella enterica subsp. enterica serovar Singapore tRNA-Cys
    3912. Salmonella enterica subsp. enterica serovar Sinstorf tRNA-Cys
    3913. Salmonella enterica subsp. enterica serovar Sloterdijk str. ATCC 15791 tRNA-Cys
    3914. Salmonella enterica subsp. enterica serovar Soerenga str. 695 tRNA-Cys
    3915. Salmonella enterica subsp. enterica serovar Soerenga tRNA-Cys
    3916. Salmonella enterica subsp. enterica serovar Solt tRNA-Cys
    3917. Salmonella enterica subsp. enterica serovar Somone tRNA-Cys
    3918. Salmonella enterica subsp. enterica serovar Southampton tRNA-Cys
    3919. Salmonella enterica subsp. enterica serovar Stanley str. ATCC 7308 tRNA-Cys
    3920. Salmonella enterica subsp. enterica serovar Stanley str. CFSAN000623 tRNA-Cys
    3921. Salmonella enterica subsp. enterica serovar Stanley tRNA-Cys(gca)
    3922. Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 tRNA-Cys
    3923. Salmonella enterica subsp. enterica serovar Stanleyville tRNA-Cys
    3924. Salmonella enterica subsp. enterica serovar Stockholm tRNA-Cys
    3925. Salmonella enterica subsp. enterica serovar Stourbridge tRNA-Cys
    3926. Salmonella enterica subsp. enterica serovar Strathcona tRNA-Cys
    3927. Salmonella enterica subsp. enterica serovar Stuttgart tRNA-Cys
    3928. Salmonella enterica subsp. enterica serovar Suberu tRNA-Cys
    3929. Salmonella enterica subsp. enterica serovar Sundsvall tRNA-Cys
    3930. Salmonella enterica subsp. enterica serovar Szentes tRNA-Cys
    3931. Salmonella enterica subsp. enterica serovar Takoradi tRNA-Cys
    3932. Salmonella enterica subsp. enterica serovar Tallahassee str. 0012 tRNA-Cys
    3933. Salmonella enterica subsp. enterica serovar Tallahassee tRNA-Cys
    3934. Salmonella enterica subsp. enterica serovar Tamale tRNA-Cys
    3935. Salmonella enterica subsp. enterica serovar Tamberma tRNA-Cys
    3936. Salmonella enterica subsp. enterica serovar Tananarive tRNA-Cys
    3937. Salmonella enterica subsp. enterica serovar Tanger tRNA-Cys
    3938. Salmonella enterica subsp. enterica serovar Tchad tRNA-Cys
    3939. Salmonella enterica subsp. enterica serovar Teddington tRNA-Cys
    3940. Salmonella enterica subsp. enterica serovar Tees tRNA-Cys
    3941. Salmonella enterica subsp. enterica serovar Teko tRNA-Cys
    3942. Salmonella enterica subsp. enterica serovar Telaviv tRNA-Cys
    3943. Salmonella enterica subsp. enterica serovar Telelkebir tRNA-Cys
    3944. Salmonella enterica subsp. enterica serovar Telhashomer tRNA-Cys
    3945. Salmonella enterica subsp. enterica serovar Tennessee str. 2691 tRNA-Cys
    3946. Salmonella enterica subsp. enterica serovar Tennessee str. 3133 tRNA-Cys
    3947. Salmonella enterica subsp. enterica serovar Tennessee str. 4535 tRNA-Cys
    3948. Salmonella enterica subsp. enterica serovar Tennessee str. PBO2007 tRNA-Cys
    3949. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-19 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3950. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-21 tRNA-Cys
    3951. Salmonella enterica subsp. enterica serovar Tennessee tRNA-Cys
    3952. Salmonella enterica subsp. enterica serovar Teshie tRNA-Cys
    3953. Salmonella enterica subsp. enterica serovar Texas tRNA-Cys
    3954. Salmonella enterica subsp. enterica serovar Thompson str. ATCC 8391 tRNA-Cys
    3955. Salmonella enterica subsp. enterica serovar Thompson str. CFSAN000625 tRNA-Cys
    3956. Salmonella enterica subsp. enterica serovar Thompson str. RM6836 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3957. Salmonella enterica subsp. enterica serovar Thompson tRNA-Cys(gca)
    3958. Salmonella enterica subsp. enterica serovar Tilene tRNA-Cys
    3959. Salmonella enterica subsp. enterica serovar Togba tRNA-Cys
    3960. Salmonella enterica subsp. enterica serovar Toucra tRNA-Cys
    3961. Salmonella enterica subsp. enterica serovar Toulon tRNA-Cys
    3962. Salmonella enterica subsp. enterica serovar Treforest tRNA-Cys
    3963. Salmonella enterica subsp. enterica serovar Tudu tRNA-Cys
    3964. Salmonella enterica subsp. enterica serovar Typhimurium str. 104772 tRNA-Cys
    3965. Salmonella enterica subsp. enterica serovar Typhimurium str. 108402 tRNA-Cys
    3966. Salmonella enterica subsp. enterica serovar Typhimurium str. 116045 tRNA-Cys
    3967. Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3968. Salmonella enterica subsp. enterica serovar Typhimurium str. 34502 tRNA-Cys
    3969. Salmonella enterica subsp. enterica serovar Typhimurium str. 35423 tRNA-Cys
    3970. Salmonella enterica subsp. enterica serovar Typhimurium str. 36618 tRNA-Cys
    3971. Salmonella enterica subsp. enterica serovar Typhimurium str. 798 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3972. Salmonella enterica subsp. enterica serovar Typhimurium str. 86-0368 tRNA-Cys
    3973. Salmonella enterica subsp. enterica serovar Typhimurium str. 95799 tRNA-Cys
    3974. Salmonella enterica subsp. enterica serovar Typhimurium str. 98346 tRNA-Cys
    3975. Salmonella enterica subsp. enterica serovar Typhimurium str. AZ 057 tRNA-Cys
    3976. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1153 tRNA-Cys
    3977. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1158 tRNA-Cys
    3978. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1277 tRNA-Cys
    3979. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1283 tRNA-Cys
    3980. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1288 tRNA-Cys
    3981. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 tRNA-Cys
    3982. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-2059 tRNA-Cys
    3983. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 tRNA-Cys
    3984. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3985. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 tRNA-Cys
    3986. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 tRNA-Cys
    3987. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000648 tRNA-Cys
    3988. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000653 tRNA-Cys
    3989. Salmonella enterica subsp. enterica serovar Typhimurium str. D23580 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3990. Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3991. Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3992. Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3993. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4_delta.ramA::kan tRNA-Cys
    3994. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4 tRNA-Cys
    3995. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3996. Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 tRNA-Cys
    3997. Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    3998. Salmonella enterica subsp. enterica serovar Typhimurium str. ST1489 tRNA-Cys
    3999. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4581 tRNA-Cys
    4000. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4/74 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4001. Salmonella enterica subsp. enterica serovar Typhimurium str. STm10 tRNA-Cys
    4002. Salmonella enterica subsp. enterica serovar Typhimurium str. STm11 tRNA-Cys
    4003. Salmonella enterica subsp. enterica serovar Typhimurium str. STm12 tRNA-Cys
    4004. Salmonella enterica subsp. enterica serovar Typhimurium str. STm1 tRNA-Cys
    4005. Salmonella enterica subsp. enterica serovar Typhimurium str. STm2 tRNA-Cys
    4006. Salmonella enterica subsp. enterica serovar Typhimurium str. STm3 tRNA-Cys
    4007. Salmonella enterica subsp. enterica serovar Typhimurium str. STm4 tRNA-Cys
    4008. Salmonella enterica subsp. enterica serovar Typhimurium str. STm5 tRNA-Cys
    4009. Salmonella enterica subsp. enterica serovar Typhimurium str. STm6 tRNA-Cys
    4010. Salmonella enterica subsp. enterica serovar Typhimurium str. STm7 tRNA-Cys
    4011. Salmonella enterica subsp. enterica serovar Typhimurium str. STm8 tRNA-Cys
    4012. Salmonella enterica subsp. enterica serovar Typhimurium str. STm9 tRNA-Cys
    4013. Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4014. Salmonella enterica subsp. enterica serovar Typhimurium str. U288 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4015. Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4016. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 tRNA-Cys
    4017. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 tRNA-Cys
    4018. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 tRNA-Cys
    4019. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 tRNA-Cys
    4020. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 tRNA-Cys
    4021. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4022. Salmonella enterica subsp. enterica serovar Typhimurium tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4023. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN001921 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4024. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN004345 tRNA-Cys
    4025. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- tRNA-Cys
    4026. Salmonella enterica subsp. enterica serovar Typhimurium var. Copenhagen str. 0084 tRNA-Cys
    4027. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,[5],12:i:- tRNA-Cys
    4028. Salmonella enterica subsp. enterica serovar Typhi str. 404ty tRNA-Cys
    4029. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000626 tRNA-Cys
    4030. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000628 tRNA-Cys
    4031. Salmonella enterica subsp. enterica serovar Typhi str. CT18 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4032. Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4033. Salmonella enterica subsp. enterica serovar Typhi str. STH2370 tRNA-Cys
    4034. Salmonella enterica subsp. enterica serovar Typhi str. Ty21a tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4035. Salmonella enterica subsp. enterica serovar Typhi str. Ty2 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4036. Salmonella enterica subsp. enterica serovar Typhisuis str. CFSAN000654 tRNA-Cys
    4037. Salmonella enterica subsp. enterica serovar Typhisuis tRNA-Cys(gca)
    4038. Salmonella enterica subsp. enterica serovar Typhi tRNA-Cys(gca)
    4039. Salmonella enterica subsp. enterica serovar Tyresoe tRNA-Cys
    4040. Salmonella enterica subsp. enterica serovar Uganda str. R8-3404 tRNA-Cys
    4041. Salmonella enterica subsp. enterica serovar Uganda tRNA-Cys
    4042. Salmonella enterica subsp. enterica serovar Ughelli tRNA-Cys
    4043. Salmonella enterica subsp. enterica serovar Ullevi tRNA-Cys
    4044. Salmonella enterica subsp. enterica serovar Umbilo tRNA-Cys
    4045. Salmonella enterica subsp. enterica serovar Uppsala tRNA-Cys
    4046. Salmonella enterica subsp. enterica serovar Urbana str. ATCC 9261 tRNA-Cys
    4047. Salmonella enterica subsp. enterica serovar Urbana str. R8-2977 tRNA-Cys
    4048. Salmonella enterica subsp. enterica serovar Urbana tRNA-Cys
    4049. Salmonella enterica subsp. enterica serovar Utah tRNA-Cys
    4050. Salmonella enterica subsp. enterica serovar Uzaramo tRNA-Cys
    4051. Salmonella enterica subsp. enterica serovar Vaertan tRNA-Cys
    4052. Salmonella enterica subsp. enterica serovar Vancouver tRNA-Cys
    4053. Salmonella enterica subsp. enterica serovar Vejle tRNA-Cys
    4054. Salmonella enterica subsp. enterica serovar Veneziana tRNA-Cys
    4055. Salmonella enterica subsp. enterica serovar Vinohrady tRNA-Cys
    4056. Salmonella enterica subsp. enterica serovar Virchow str. ATCC 51955 tRNA-Cys
    4057. Salmonella enterica subsp. enterica serovar Virchow str. SL491 tRNA-Cys
    4058. Salmonella enterica subsp. enterica serovar Virchow str. SVQ1 tRNA-Cys
    4059. Salmonella enterica subsp. enterica serovar Virchow tRNA-Cys
    4060. Salmonella enterica subsp. enterica serovar Virginia str. SA19971529 tRNA-Cys
    4061. Salmonella enterica subsp. enterica serovar Virginia tRNA-Cys
    4062. Salmonella enterica subsp. enterica serovar Vitkin tRNA-Cys
    4063. Salmonella enterica subsp. enterica serovar Volkmarsdorf tRNA-Cys
    4064. Salmonella enterica subsp. enterica serovar Vom tRNA-Cys
    4065. Salmonella enterica subsp. enterica serovar Wagenia tRNA-Cys
    4066. Salmonella enterica subsp. enterica serovar Wandsworth str. A4-580 tRNA-Cys
    4067. Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 tRNA-Cys
    4068. Salmonella enterica subsp. enterica serovar Wandsworth tRNA-Cys
    4069. Salmonella enterica subsp. enterica serovar Wangata tRNA-Cys
    4070. Salmonella enterica subsp. enterica serovar Warnow tRNA-Cys
    4071. Salmonella enterica subsp. enterica serovar Washington tRNA-Cys
    4072. Salmonella enterica subsp. enterica serovar Wa tRNA-Cys
    4073. Salmonella enterica subsp. enterica serovar Waycross tRNA-Cys
    4074. Salmonella enterica subsp. enterica serovar Wedding tRNA-Cys
    4075. Salmonella enterica subsp. enterica serovar Welikade tRNA-Cys
    4076. Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 tRNA-Cys
    4077. Salmonella enterica subsp. enterica serovar Weltevreden str. 2007-60-3289-1 tRNA-Cys
    4078. Salmonella enterica subsp. enterica serovar Weltevreden tRNA-Cys(gca)
    4079. Salmonella enterica subsp. enterica serovar Wentworth tRNA-Cys
    4080. Salmonella enterica subsp. enterica serovar Weslaco str. 247K tRNA-Cys
    4081. Salmonella enterica subsp. enterica serovar Weslaco tRNA-Cys
    4082. Salmonella enterica subsp. enterica serovar Westhampton tRNA-Cys
    4083. Salmonella enterica subsp. enterica serovar Westminster tRNA-Cys
    4084. Salmonella enterica subsp. enterica serovar Weston tRNA-Cys
    4085. Salmonella enterica subsp. enterica serovar Weybridge tRNA-Cys
    4086. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000656 tRNA-Cys
    4087. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000657 tRNA-Cys
    4088. Salmonella enterica subsp. enterica serovar Wien tRNA-Cys
    4089. Salmonella enterica subsp. enterica serovar Wilhelmsburg tRNA-Cys
    4090. Salmonella enterica subsp. enterica serovar Winterthur tRNA-Cys
    4091. Salmonella enterica subsp. enterica serovar Woodhull tRNA-Cys
    4092. Salmonella enterica subsp. enterica serovar Woodinville tRNA-Cys
    4093. Salmonella enterica subsp. enterica serovar Worthington str. ATCC 9607 tRNA-Cys
    4094. Salmonella enterica subsp. enterica serovar Worthington tRNA-Cys
    4095. Salmonella enterica subsp. enterica serovar Yolo tRNA-Cys
    4096. Salmonella enterica subsp. enterica serovar Yoruba tRNA-Cys
    4097. Salmonella enterica subsp. enterica serovar Yovokome str. S-1850 tRNA-Cys
    4098. Salmonella enterica subsp. enterica serovar Yovokome tRNA-Cys
    4099. Salmonella enterica subsp. enterica serovar Zaiman tRNA-Cys
    4100. Salmonella enterica subsp. enterica serovar Zanzibar tRNA-Cys
    4101. Salmonella enterica subsp. enterica tRNA-Cys(gca)
    4102. Salmonella enterica subsp. houtenae serovar 1,40:z4,z32:- tRNA-Cys
    4103. Salmonella enterica subsp. houtenae serovar 16:z4,z32:- tRNA-Cys
    4104. Salmonella enterica subsp. houtenae serovar 18:z36,z38:- tRNA-Cys
    4105. Salmonella enterica subsp. houtenae serovar 21:z4,z23:- tRNA-Cys
    4106. Salmonella enterica subsp. houtenae serovar 40:z4,z24:- tRNA-Cys
    4107. Salmonella enterica subsp. houtenae serovar 40:z4,z32:- tRNA-Cys
    4108. Salmonella enterica subsp. houtenae serovar 41:z4,z23:- tRNA-Cys
    4109. Salmonella enterica subsp. houtenae serovar 43:z4 tRNA-Cys
    4110. Salmonella enterica subsp. houtenae serovar 43:z4,z23:- tRNA-Cys
    4111. Salmonella enterica subsp. houtenae serovar 43:z4,z32:- tRNA-Cys
    4112. Salmonella enterica subsp. houtenae serovar 44:z36[z38]:- tRNA-Cys
    4113. Salmonella enterica subsp. houtenae serovar 44:z4,z23:- tRNA-Cys
    4114. Salmonella enterica subsp. houtenae serovar 44:z4,z24:- tRNA-Cys
    4115. Salmonella enterica subsp. houtenae serovar 45:g,z51:- tRNA-Cys
    4116. Salmonella enterica subsp. houtenae serovar 48:g,z51:- tRNA-Cys
    4117. Salmonella enterica subsp. houtenae serovar 48:z4,z32:- tRNA-Cys
    4118. Salmonella enterica subsp. houtenae serovar 50:g,z51:- str. 01-0133 tRNA-Cys
    4119. Salmonella enterica subsp. houtenae serovar 50:g,z51:- tRNA-Cys
    4120. Salmonella enterica subsp. houtenae serovar 50:z4,z23:- tRNA-Cys
    4121. Salmonella enterica subsp. houtenae serovar 53:z4,z23:- tRNA-Cys
    4122. Salmonella enterica subsp. houtenae serovar Houten tRNA-Cys(gca)
    4123. Salmonella enterica subsp. houtenae str. ATCC BAA-1581 tRNA-Cys
    4124. Salmonella enterica subsp. houtenae str. CFSAN000552 tRNA-Cys
    4125. Salmonella enterica subsp. houtenae str. CFSAN000557 tRNA-Cys
    4126. Salmonella enterica subsp. houtenae tRNA-Cys(gca)
    4127. Salmonella enterica subsp. indica serovar 41:b:1,7 tRNA-Cys
    4128. Salmonella enterica subsp. indica serovar 45:a:e,n,x tRNA-Cys
    4129. Salmonella enterica subsp. indica serovar 6,14,25:z10:1,(2),7 str. 1121 tRNA-Cys
    4130. Salmonella enterica subsp. indica serovar Marseille tRNA-Cys
    4131. Salmonella enterica subsp. indica tRNA-Cys(gca)
    4132. Salmonella enterica subsp. salamae serovar 18:z10:z6 tRNA-Cys
    4133. Salmonella enterica subsp. salamae serovar 30:1,z28:z6 tRNA-Cys
    4134. Salmonella enterica subsp. salamae serovar 42:b:1,5 tRNA-Cys
    4135. Salmonella enterica subsp. salamae serovar 42:f,g,t:-- tRNA-Cys
    4136. Salmonella enterica subsp. salamae serovar 42:r:- tRNA-Cys
    4137. Salmonella enterica subsp. salamae serovar 42:z:1,5 tRNA-Cys
    4138. Salmonella enterica subsp. salamae serovar 47:a:1,5 tRNA-Cys
    4139. Salmonella enterica subsp. salamae serovar 47:b:1,5 tRNA-Cys
    4140. Salmonella enterica subsp. salamae serovar 48:d:z6 tRNA-Cys
    4141. Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K tRNA-Cys
    4142. Salmonella enterica subsp. salamae serovar 56:b:[1,5] tRNA-Cys
    4143. Salmonella enterica subsp. salamae serovar 56:z10:e,n,x str. 1369-73 tRNA-Cys
    4144. Salmonella enterica subsp. salamae serovar 57:z29:z42 tRNA-Cys
    4145. Salmonella enterica subsp. salamae serovar 58:a:- tRNA-Cys
    4146. Salmonella enterica subsp. salamae serovar 58:d:z6 tRNA-Cys
    4147. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 str. 00-0163 tRNA-Cys
    4148. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 tRNA-Cys
    4149. Salmonella enterica subsp. salamae serovar 60:g,m,t:z6 tRNA-Cys
    4150. Salmonella enterica subsp. salamae serovar 6,7:m,t:- tRNA-Cys
    4151. Salmonella enterica subsp. salamae serovar Greenside tRNA-Cys(gca)
    4152. Salmonella enterica subsp. salamae serovar Sofia tRNA-Cys
    4153. Salmonella enterica subsp. salamae serovar Springs tRNA-Cys
    4154. Salmonella enterica subsp. salamae str. CFSAN000559 tRNA-Cys
    4155. Salmonella enterica subsp. salamae tRNA-Cys(gca)
    4156. Salmonella enterica subsp. VII serovar 1,40:g,z51:-- tRNA-Cys
    4157. Salmonella enterica subsp. VII serovar 40:z4,z24:[z39] tRNA-Cys
    4158. Salmonella enterica subsp. VII str. CFSAN000554 tRNA-Cys
    4159. Salmonella enterica tRNA-Cys(gca)
    4160. Salmonella sp. 32010201201800099SM tRNA-Cys
    4161. Salmonella sp. 32010601-2015-00010-FB-01-SM-01 tRNA-Cys
    4162. Salmonella sp. 32010601-2015-00137-FB-01-SM-01 tRNA-Cys
    4163. Salmonella sp. 32010601201600049SM tRNA-Cys
    4164. Salmonella sp. 32010601201600067SM tRNA-Cys
    4165. Salmonella sp. 32010601201800023SM tRNA-Cys
    4166. Salmonella sp. 32010601201800030SM tRNA-Cys
    4167. Salmonella sp. 32011103201800031SM tRNA-Cys
    4168. Salmonella sp. 32011103201800106SM tRNA-Cys
    4169. Salmonella sp. 32011401201800036SM tRNA-Cys
    4170. Salmonella sp. 32011401-201800074SM tRNA-Cys
    4171. Salmonella sp. 32011501201800079SM tRNA-Cys
    4172. Salmonella sp. 32011602201600097SM tRNA-Cys
    4173. Salmonella sp. 32011602201600105SM tRNA-Cys
    4174. Salmonella sp. 32011602201800010SM tRNA-Cys
    4175. Salmonella sp. 32011602201800014SM tRNA-Cys
    4176. Salmonella sp. 32011801201800027SM tRNA-Cys
    4177. Salmonella sp. 32020114201800008SM tRNA-Cys
    4178. Salmonella sp. 32020201-2017-00050-FB-01-SM-01 tRNA-Cys
    4179. Salmonella sp. 32020210201800012SM tRNA-Cys
    4180. Salmonella sp. 32020301-2015-00098-FB-01-SM-01 tRNA-Cys
    4181. Salmonella sp. 32020501-2015-00069-FB-01-SM-01 tRNA-Cys
    4182. Salmonella sp. 32020501-2019-00039 tRNA-Cys
    4183. Salmonella sp. 32020501-2019-00040 tRNA-Cys
    4184. Salmonella sp. 32020501-2019-00041 tRNA-Cys
    4185. Salmonella sp. 32020501-2019-00044 tRNA-Cys
    4186. Salmonella sp. 32020501-2019-00050 tRNA-Cys
    4187. Salmonella sp. 32020501-2019-00052 tRNA-Cys
    4188. Salmonella sp. 32020509201800054SM tRNA-Cys
    4189. Salmonella sp. 32020509201800068SM tRNA-Cys
    4190. Salmonella sp. 32020512-2019-00017 tRNA-Cys
    4191. Salmonella sp. 32020614-2019-00048 tRNA-Cys
    4192. Salmonella sp. 32021105201800037SM tRNA-Cys
    4193. Salmonella sp. 32031101201600128SM tRNA-Cys
    4194. Salmonella sp. 3203110320150095SM tRNA-Cys
    4195. Salmonella sp. 3203110320150106SM tRNA-Cys
    4196. Salmonella sp. 32031103201600220SM tRNA-Cys
    4197. Salmonella sp. 32031103201600241SM tRNA-Cys
    4198. Salmonella sp. 32031103201600284SM tRNA-Cys
    4199. Salmonella sp. 32031103201600383SM tRNA-Cys
    4200. Salmonella sp. 3203110320160044 tRNA-Cys
    4201. Salmonella sp. 3203110320160052 tRNA-Cys
    4202. Salmonella sp. 3203110320160127 tRNA-Cys
    4203. Salmonella sp. 3203110320160165 tRNA-Cys
    4204. Salmonella sp. 3203110320160211 tRNA-Cys
    4205. Salmonella sp. 32031103-2018-00083-FB-01-SM-01 tRNA-Cys
    4206. Salmonella sp. 32031103-2018-0023-FB-01-SM-01 tRNA-Cys
    4207. Salmonella sp. 32040202-2015-00022-FB-01-SM-01 tRNA-Cys
    4208. Salmonella sp. 32040203201700040FB01SM01 tRNA-Cys
    4209. Salmonella sp. 32040203201700113FB01SM01 tRNA-Cys
    4210. Salmonella sp. 32040203-2019-00004 tRNA-Cys
    4211. Salmonella sp. 32040203-2019-00032 tRNA-Cys
    4212. Salmonella sp. 32040203-2019-00058 tRNA-Cys
    4213. Salmonella sp. 32040203-2019-00061 tRNA-Cys
    4214. Salmonella sp. 32040203-2019-00097 tRNA-Cys
    4215. Salmonella sp. 32040203-2019-00118 tRNA-Cys
    4216. Salmonella sp. 32040203-2019-00127 tRNA-Cys
    4217. Salmonella sp. 32040203-2019-00133 tRNA-Cys
    4218. Salmonella sp. 32040203-2019-00159 tRNA-Cys
    4219. Salmonella sp. 32040203-2019-00173 tRNA-Cys
    4220. Salmonella sp. 32040209201700048FB01SM01 tRNA-Cys
    4221. Salmonella sp. 32048101-2015-00023-GS-01-SM-01 tRNA-Cys
    4222. Salmonella sp. 32048101-2015-00025-GS-01-SM-01 tRNA-Cys
    4223. Salmonella sp. 32058101201500184GS-01-SM-01 tRNA-Cys
    4224. Salmonella sp. 32070006-2019-00075 tRNA-Cys
    4225. Salmonella sp. 32070301201500052SM tRNA-Cys
    4226. Salmonella sp. 32070601201500089SM tRNA-Cys
    4227. Salmonella sp. 32070601201800144SM tRNA-Cys
    4228. Salmonella sp. 32080201-2017-00039-FB-01-SM-01 tRNA-Cys
    4229. Salmonella sp. 32081101-2017-00024-FB-01-SM-01 tRNA-Cys
    4230. Salmonella sp. 32082101201600294FB01SM01 tRNA-Cys
    4231. Salmonella sp. 32082101-2017-00322-FB-01-SM-01 tRNA-Cys
    4232. Salmonella sp. 32082101-2019-00528 tRNA-Cys
    4233. Salmonella sp. 32090202-2015-00079-FB-01-SM-01 tRNA-Cys
    4234. Salmonella sp. 32100201201700021SM tRNA-Cys
    4235. Salmonella sp. 32100201201700044SM tRNA-Cys
    4236. Salmonella sp. 32100201201700098SM tRNA-Cys
    4237. Salmonella sp. 32100201201700099SM tRNA-Cys
    4238. Salmonella sp. 32100201201700133SM tRNA-Cys
    4239. Salmonella sp. 32100202201700047SM tRNA-Cys
    4240. Salmonella sp. 32100202201700100SM tRNA-Cys
    4241. Salmonella sp. 32101201-2018-00131-FB-01-SM-01 tRNA-Cys
    4242. Salmonella sp. 32118201201500025SM tRNA-Cys
    4243. Salmonella sp. 32120201201500036SM tRNA-Cys
    4244. Salmonella sp. 32120201201600049SM tRNA-Cys
    4245. Salmonella sp. 32120201201600070SM tRNA-Cys
    4246. Salmonella sp. 32120201201700095FB-01-SM-01 tRNA-Cys
    4247. Salmonella sp. 32120201201700135FB-01-SM-01 tRNA-Cys
    4248. Salmonella sp. 32120201201700237FB-01-SM-01 tRNA-Cys
    4249. Salmonella sp. 32120202201500105SM tRNA-Cys
    4250. Salmonella sp. 32120202201500174SM tRNA-Cys
    4251. Salmonella sp. 32120202201600072SM tRNA-Cys
    4252. Salmonella sp. 32120202201600097SM tRNA-Cys
    4253. Salmonella sp. 32120202201600158SM tRNA-Cys
    4254. Salmonella sp. 32120203201500024SM tRNA-Cys
    4255. Salmonella sp. 32120203201700065FB-01-SM-01 tRNA-Cys
    4256. Salmonella sp. 32130201201500050SM tRNA-Cys
    4257. Salmonella sp. 32130201-2017-00038SM tRNA-Cys
    4258. Salmonella sp. 32132402-2017-00107SM tRNA-Cys
    4259. Salmonella sp. 3DZ2-4SM tRNA-Cys
    4260. Salmonella sp. D5-9891 tRNA-Cys
    4261. Salmonella sp. gx-f9 tRNA-Cys
    4262. Salmonella sp. hn-h4 tRNA-Cys
    4263. Salmonella sp. HNK130 tRNA-Cys
    4264. Salmonella sp. JS051105201500009SM tRNA-Cys
    4265. Salmonella sp. NCTC 11881 tRNA-Cys(gca)
    4266. Salmonella sp. NCTC 3046 tRNA-Cys(gca)
    4267. Salmonella sp. NCTC 6947 tRNA-Cys(gca)
    4268. Salmonella sp. NCTC 7297 tRNA-Cys(gca)
    4269. Salmonella sp. S13 tRNA-Cys
    4270. Salmonella sp. SAL-007 tRNA-Cys
    4271. Salmonella sp. SAL-020 tRNA-Cys
    4272. Salmonella sp. SAL-045 tRNA-Cys
    4273. Salmonella sp. SCFS4 tRNA-Cys
    4274. Salmonella sp. sc-h43 tRNA-Cys
    4275. Salmonella sp. SJTUF14076 tRNA-Cys
    4276. Salmonella sp. SJTUF14146 tRNA-Cys
    4277. Salmonella sp. SJTUF14152 tRNA-Cys
    4278. Salmonella sp. SJTUF14154 tRNA-Cys
    4279. Salmonella sp. SJTUF14170 tRNA-Cys
    4280. Salmonella sp. SJTUF14178 tRNA-Cys
    4281. Salmonella sp. SJTUF14523 tRNA-Cys
    4282. Salmonella sp. SJTUF15034 tRNA-Cys
    4283. Salmonella sp. SSDFZ54 tRNA-Cys
    4284. Salmonella sp. SSDFZ69 tRNA-Cys
    4285. Salmonella sp. XN2 tRNA-Cys
    4286. Salmonella sp. zj-f100 tRNA-Cys
    4287. Salmonella sp. zj-f95 tRNA-Cys
    4288. Serratia ficaria tRNA-Cys(gca)
    4289. Serratia fonticola tRNA-Cys(gca)
    4290. Serratia grimesii tRNA-Cys(gca)
    4291. Serratia liquefaciens ATCC 27592 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4292. Serratia liquefaciens FK01 tRNA-Cys
    4293. Serratia liquefaciens tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4294. Serratia odorifera DSM 4582 tRNA-Cys
    4295. Serratia odorifera tRNA-Cys(gca)
    4296. Serratia oryzae tRNA-Cys
    4297. Serratia plymuthica 4Rx13 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4298. Serratia plymuthica A30 tRNA-Cys
    4299. Serratia plymuthica AS9 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4300. Serratia inhibens PRI-2C tRNA-Cys
    4301. Serratia plymuthica RVH1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4302. Serratia plymuthica S13 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4303. Serratia plymuthica tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4304. Serratia proteamaculans 568 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4305. Serratia proteamaculans tRNA-Cys
    4306. Serratia quinivorans tRNA-Cys(gca)
    4307. Serratia rubidaea tRNA-Cys(gca)
    4308. Serratia sp. 14-2641 tRNA-Cys
    4309. Serratia sp. 3ACOL1 tRNA-Cys
    4310. Serratia sp. Ag1 tRNA-Cys
    4311. Serratia sp. Ag2 tRNA-Cys
    4312. Serratia sp. AS12 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4313. Serratia sp. AS13 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4314. Serratia sp. DD3 tRNA-Cys
    4315. Serratia sp. FGI94 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4316. Serratia sp. JUb9 tRNA-Cys
    4317. Serratia rhizosphaerae tRNA-Cys
    4318. Serratia sp. LCN16 tRNA-Cys(gca)
    4319. Serratia sp. MYb239 tRNA-Cys
    4320. Serratia sp. OS31 tRNA-Cys
    4321. Serratia sp. P2ACOL2 tRNA-Cys
    4322. Serratia sp. PAMC26656 tRNA-Cys
    4323. Serratia sp. PL17 tRNA-Cys
    4324. Serratia inhibens tRNA-Cys
    4325. Serratia sp. Tan611 Cys tRNA
    4326. Serratia sp. tRNA-Cys
    4327. Serratia ficaria tRNA-Cys
    4328. Shigella boydii 3594-74 tRNA-Cys
    4329. Shigella boydii 4444-74 tRNA-Cys
    4330. Shigella boydii 5216-82 tRNA-Cys
    4331. Shigella boydii 965-58 tRNA-Cys
    4332. Shigella boydii CDC 3083-94 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4333. Shigella boydii Sb227 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4334. Shigella boydii tRNA-Cys
    4335. Shigella dysenteriae 1012 tRNA-Cys
    4336. Shigella dysenteriae 155-74 tRNA-Cys
    4337. Shigella dysenteriae 1617 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4338. Shigella dysenteriae 225-75 tRNA-Cys
    4339. Shigella dysenteriae Sd197 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4340. Shigella dysenteriae tRNA-Cys(gca)
    4341. Shigella dysenteriae WRSd3 tRNA-Cys
    4342. Shigella flexneri 1485-80 tRNA-Cys
    4343. Shigella flexneri 1a tRNA-Cys
    4344. Shigella flexneri 1b tRNA-Cys
    4345. Shigella flexneri 1c tRNA-Cys
    4346. Shigella flexneri 2002017 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4347. Shigella flexneri 2003036 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4348. Shigella flexneri 2747-71 tRNA-Cys
    4349. Shigella flexneri 2850-71 tRNA-Cys
    4350. Shigella flexneri 2930-71 tRNA-Cys
    4351. Shigella flexneri 2a str. 2457T tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4352. Shigella flexneri 2a str. 301 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4353. Shigella flexneri 2a tRNA-Cys(gca)
    4354. Shigella flexneri 2b tRNA-Cys(gca)
    4355. Shigella flexneri 3a tRNA-Cys
    4356. Shigella flexneri 3b tRNA-Cys
    4357. Shigella flexneri 4343-70 tRNA-Cys
    4358. Shigella flexneri 4c tRNA-Cys
    4359. Shigella flexneri 5a str. M90T tRNA-Cys
    4360. Shigella flexneri 5 str. 8401 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4361. Shigella flexneri 6603-63 tRNA-Cys
    4362. Shigella flexneri CCH060 tRNA-Cys
    4363. Shigella flexneri G1663 tRNA-Cys
    4364. Shigella flexneri K-1770 tRNA-Cys
    4365. Shigella flexneri K-218 tRNA-Cys
    4366. Shigella flexneri K-227 tRNA-Cys
    4367. Shigella flexneri K-272 tRNA-Cys
    4368. Shigella flexneri K-304 tRNA-Cys
    4369. Shigella flexneri K-315 tRNA-Cys
    4370. Shigella flexneri K-404 tRNA-Cys
    4371. Shigella flexneri K-671 tRNA-Cys
    4372. Shigella flexneri SFJ17B tRNA-Cys
    4373. Shigella flexneri Shi06HN006 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4374. Shigella flexneri tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4375. Shigella flexneri VA-6 tRNA-Cys
    4376. Shigella flexneri Y tRNA-Cys
    4377. Shigella sonnei 3226-85 tRNA-Cys
    4378. Shigella sonnei 3233-85 tRNA-Cys
    4379. Shigella sonnei 4822-66 tRNA-Cys
    4380. Shigella sonnei 53G tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4381. Shigella sonnei Ss046 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    4382. Shigella sonnei str. Moseley tRNA-Cys
    4383. Shigella sonnei tRNA-Cys(gca)
    4384. Shigella sp. FC1056 tRNA-Cys
    4385. Shigella sp. FC1139 tRNA-Cys
    4386. Shigella sp. FC1172 tRNA-Cys
    4387. Shigella sp. FC1180 tRNA-Cys
    4388. Shigella sp. FC1544 tRNA-Cys
    4389. Shigella sp. FC1567 tRNA-Cys
    4390. Shigella sp. FC1661 tRNA-Cys
    4391. Shigella sp. FC1708 tRNA-Cys
    4392. Shigella sp. FC1737 tRNA-Cys
    4393. Shigella sp. FC1764 tRNA-Cys
    4394. Shigella sp. FC1882 tRNA-Cys
    4395. Shigella sp. FC2045 tRNA-Cys
    4396. Shigella sp. FC2117 tRNA-Cys
    4397. Shigella sp. FC2125 tRNA-Cys
    4398. Shigella sp. FC2175 tRNA-Cys
    4399. Shigella sp. FC2383 tRNA-Cys
    4400. Shigella sp. FC2531 tRNA-Cys
    4401. Shigella sp. FC2541 tRNA-Cys
    4402. Shigella sp. FC2710 tRNA-Cys
    4403. Shigella sp. FC2833 tRNA-Cys
    4404. Shigella sp. FC2928 tRNA-Cys
    4405. Shigella sp. FC3196 tRNA-Cys
    4406. Shigella sp. FC569 tRNA-Cys
    4407. Shigella sp. PAMC 28760 tRNA-Cys
    4408. Shigella sp. tRNA-Cys
    4409. Streptococcus pneumoniae tRNA-Cys(gca)
    4410. synthetic Escherichia coli C321.deltaA tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
    2D structure New