Pan troglodytes (chimpanzee) ptr-miR-141 URS000003E1A9_9598

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 8 other species
• 175 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAACACUGUCUGGUAAAGAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

1. Bos taurus (cattle) bta-miR-141
2. Capra hircus (goat) chi-miR-141
3. Equus caballus (horse) eca-miR-141
4. Homo sapiens (human) hsa-miR-141-3p
5. Mus musculus (house mouse) mmu-miR-141-3p
6. Ovis aries miscellaneous RNA
7. Pteropus alecto pal-miR-141-3p
8. Rattus norvegicus (Norway rat) rno-miR-141-3p

Publications Download

• FASTA
• JSON