Automated summary: This rRNA sequence is 116 nucleotides long and is found in Burkholderia pseudomallei K96243. Annotated by 2 databases (ENA, RefSeq). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (5S_rRNA, RF00001).
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UGCCUGAUGACCAUAGCGAGUCGGUCCCACCCCUUCCCAUCCCGAACAGGACCGUGAAACGACUCCACGCCGAUGAUAGUGCGGAUUGCCCGUGUGAAAGUAGGUAAUCGUCAGGC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.