Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-26b-3p URS000003ABC4_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-26b: Rno-mir-26b is a microRNA (miRNA) that is among the fourteen miRNAs mapped to the ingenuity databases. It has been found to have 171 experimentally validated targets [PMC3682887]. In a study examining miRNAs in the context of a hyperandrogenic condition, it was observed that 79 miRNAs responded to this condition, with 80% of them being upregulated compared to the control group. Rno-mir-26b was one of the upregulated miRNAs in this study [PMC3682887]. Additionally, rno-mir-26b was found to be highly abundant in DHT-treated ovaries [PMC3682887]. Rno-mir-26b has also been associated with cardiac hypertrophy, as it was identified in microRNA profiling studies along with other miRNAs known to be associated with this condition [PMC5856749]. In a study comparing rats with polycystic ovary syndrome (PCOS) and control rats, rno-mir-26b was found to be differentially expressed between the two groups [PMC4838149]. Furthermore, rno-mir-26b has been identified as one of the target miRNAs in various assays [PMC4113183].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGUUCUCCAUUACUUGGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Capra hircus (goat) chi-miR-26b-3p
  2. Cavia porcellus (domestic guinea pig) cpo-miR-26b-3p
  3. Cervus elaphus (red deer) cel-miR-26b-3p
  4. Cricetulus griseus (Chinese hamster) cgr-miR-26b-3p
  5. Dasypus novemcinctus dno-miR-26b-3p
  6. Homo sapiens (human) Hsa-Mir-26-P1_3p* (star (passenger))
  7. Mus musculus mmu-miR-26b-3p
  8. Oryctolagus cuniculus (rabbit) ocu-miR-26b-3p
  9. Sus scrofa (pig) ssc-mir20
Publications