Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Crassostrea gigas (Pacific oyster) Cgi-Mir-31_5p (mature (guide)) URS000003AB9C_29159

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAAGAUGUUGGCAUAGCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Anolis carolinensis Aca-Mir-31_5p (mature (guide))
  2. Ascaris suum asu-miR-72-5p
  3. Brugia malayi (agent of lymphatic filariasis) bma-miR-72
  4. Caenorhabditis elegans cel-miR-72-5p
  5. Capitella teleta Cte-Mir-31_5p (mature (guide))
  6. Eisenia fetida Efe-Mir-31_5p (mature (guide))
  7. Euprymna scolopes Esc-Mir-31_5p (mature (guide))
  8. Gallus gallus Gallus_gallus piRNA piR-gga-81
  9. Gekko japonicus Gja-Mir-31-P10_5p (mature (guide))
  10. Haemonchus contortus (barber pole worm) hco-miR-72
  11. Heligmosomoides polygyrus hpo-miR-72-5p
  12. Lingula anatina Lan-Mir-31-P6_5p (mature (guide))
  13. Lottia gigantea Lgi-Mir-31_5p (mature (guide))
  14. Melibe leonina mle-miR-31-5p
  15. Nautilus pompilius Npo-Mir-31_5p (mature (guide))
  16. Octopus bimaculoides Obi-Mir-31_5p (mature (guide))
  17. Octopus vulgaris Ovu-Mir-31_5p (mature (guide))
  18. Python bivittatus Pbv-Mir-31_5p (mature (guide))
  19. Strongyloides ratti str-miR-72-5p