Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-872-5p URS00000386E7_10090

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Mus musculus. Annotated by 7 databases (TarBase, ENA, miRBase, LncBase, MirGeneDB, RefSeq, PirBase). Mus musculus (house mouse) mmu-miR-872-5p sequence is a product of mmu-miR-872-5p, miR-872, miR-872-5p, Mir872, mmu-miR-872 genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610039A15Rik, 2310050P13Rik, 4632407P03Rik, E130103E02Rik, ENSMUSG00000027957, ENSMUSG00000030286, ENSMUSG00000033257, ENSMUSG00000038612, ENSMUSG00000066415, Emc3.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAGGUUACUUGUUAGUUCAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 54 other species

    1. Cavia porcellus cpo-miR-872-5p
    2. Cricetulus griseus cgr-miR-872-5p
    3. Equus caballus eca-miR-872
    4. Microcebus murinus mmr-miR-872
    5. Oryctolagus cuniculus (rabbit) ocu-miR-872-5p
    6. Rattus norvegicus rno-miR-872-5p
    Publications New