Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Escherichia coli tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1) secondary structure diagram

Escherichia coli tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1) URS0000036214_562

Automated summary: This tRNA sequence is 85 nucleotides long and is found in Escherichia coli. Annotated by 4 databases (GtRNAdb, PDBe, Modomics, ENA). Has a conserved secondary structure or a structured region. Has an experimentally determined 3D structure. Matches 1 Rfam family (tRNA, RF00005). Escherichia coli tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1) sequence is a product of trnL3, trnL1, tRNA-Leu-TAG-1-1, trnL2, trn13, leuW genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GCGGGAGUGGCGAAAUUGGUAGACGCACCAGAUUUAGGUUCUGGCGCCGCAAGGUGUGCGAGUUCAAGUCUCGCCUCCCGCACCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 5,858 other species

    1. Escherichia coli tRNA-Leu(tag)
    2. Acinetobacter baumannii tRNA-Leu(tag)
    3. Arsenophonus endosymbiont of Bemisia tabaci Asia II 3 tRNA-Leu
    4. Arsenophonus nasoniae (son-killer infecting Nasonia vitripennis) tRNA-Leu
    5. Atlantibacter hermannii tRNA-Leu(tag)
    6. Atlantibacter sp. RC6 tRNA-Leu
    7. Atlantibacter subterranea tRNA-Leu
    8. bacteria symbiont BFo1 of Frankliniella occidentalis tRNA-Leu
    9. bacterium RGF134-1 tRNA-Leu
    10. Brenneria alni tRNA-Leu
    11. Brenneria goodwinii tRNA-Leu
    12. Brenneria nigrifluens tRNA-Leu
    13. Brenneria roseae subsp. americana tRNA-Leu
    14. Brenneria roseae subsp. roseae tRNA-Leu
    15. Brenneria rubrifaciens tRNA-Leu
    16. Brenneria salicis ATCC 15712 = DSM 30166 tRNA-Leu
    17. Brenneria sp. CFCC 11842 tRNA-Leu
    18. Brenneria sp. EniD312 tRNA-Leu
    19. Brenneria izadpanahii tRNA-Leu
    20. Brenneria sp. L3-3C-1 tRNA-Leu
    21. Affinibrenneria salicis tRNA-Leu
    22. Budvicia aquatica tRNA-Leu(tag)
    23. Buttiauxella agrestis ATCC 33320 tRNA-Leu
    24. Buttiauxella agrestis tRNA-Leu
    25. Buttiauxella brennerae ATCC 51605 tRNA-Leu
    26. Buttiauxella ferragutiae ATCC 51602 tRNA-Leu
    27. Buttiauxella gaviniae ATCC 51604 tRNA-Leu
    28. Buttiauxella izardii tRNA-Leu
    29. Buttiauxella noackiae ATCC 51607 tRNA-Leu
    30. Buttiauxella sp. 3AFRM03 tRNA-Leu
    31. Buttiauxella sp. A111 tRNA-Leu
    32. Buttiauxella warmboldiae tRNA-Leu
    33. Candidatus Symbiopectobacterium sp. Dall1.0 (symbiont metagenome) tRNA-Leu
    34. Candidatus Symbiopectobacterium sp. 'North America' tRNA-Leu
    35. Candidatus Symbiopectobacterium sp. PLON1 tRNA-Leu
    36. Candidatus Symbiopectobacterium sp. SyEd1 tRNA-Leu
    37. Cedecea colo tRNA-Leu
    38. Cedecea davisae DSM 4568 tRNA-Leu
    39. Cedecea davisae tRNA-Leu(tag)
    40. Cedecea lapagei tRNA-Leu(tag)
    41. Cedecea neteri tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    42. Cedecea sp. FDAARGOS_727 tRNA-Leu
    43. Cedecea sp. P7760 tRNA-Leu
    44. Citrobacter amalonaticus tRNA-Leu(tag)
    45. Citrobacter amalonaticus Y19 tRNA-Leu
    46. Citrobacter braakii tRNA-Leu(tag)
    47. Citrobacter cronae tRNA-Leu
    48. Citrobacter europaeus tRNA-Leu
    49. Citrobacter farmeri GTC 1319 tRNA-Leu
    50. Citrobacter farmeri tRNA-Leu
    51. Citrobacter freundii 4_7_47CFAA tRNA-Leu
    52. Citrobacter freundii 47N tRNA-Leu
    53. Citrobacter freundii 5-172-05_S1_C1 tRNA-Leu
    54. Citrobacter freundii ATCC 8090 = MTCC 1658 = NBRC 12681 = NBRC 12681 tRNA-Leu
    55. Citrobacter freundii CFNIH1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    56. Citrobacter freundii complex sp. CFNIH11 tRNA-Leu
    57. Citrobacter freundii complex sp. CFNIH12 tRNA-Leu
    58. Citrobacter freundii complex sp. CFNIH2 tRNA-Leu
    59. Citrobacter freundii complex sp. CFNIH3 tRNA-Leu
    60. Citrobacter freundii complex sp. CFNIH4 tRNA-Leu
    61. Citrobacter freundii complex sp. CFNIH5 tRNA-Leu
    62. Citrobacter freundii complex sp. CFNIH6 tRNA-Leu
    63. Citrobacter freundii complex sp. CFNIH7 tRNA-Leu
    64. Citrobacter freundii complex sp. CFNIH8 tRNA-Leu
    65. Citrobacter freundii complex sp. CFNIH9 tRNA-Leu
    66. Citrobacter freundii GTC 09479 tRNA-Leu
    67. Citrobacter freundii GTC 09629 tRNA-Leu
    68. Citrobacter freundii MGH 56 tRNA-Leu
    69. Citrobacter freundii RLS1 tRNA-Leu
    70. Citrobacter freundii tRNA-Leu(tag)
    71. Citrobacter freundii UCI 31 tRNA-Leu
    72. Citrobacter freundii UCI 32 tRNA-Leu
    73. Citrobacter gillenii tRNA-Leu
    74. Citrobacter koseri ATCC BAA-895 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    75. Citrobacter koseri tRNA-Leu(tag)
    76. Citrobacter murliniae tRNA-Leu
    77. Citrobacter pasteurii (gut metagenome) tRNA-Leu
    78. Citrobacter portucalensis tRNA-Leu(tag)
    79. Citrobacter rodentium ICC168 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    80. Citrobacter rodentium tRNA-Leu
    81. Citrobacter sedlakii tRNA-Leu
    82. Citrobacter sp. 172116965 tRNA-Leu
    83. Citrobacter sp. 50677481 tRNA-Leu
    84. Citrobacter sp. A1 tRNA-Leu
    85. Citrobacter sp. A316 tRNA-Leu
    86. Citrobacter sp. AATXQ tRNA-Leu
    87. Citrobacter sp. AATXR tRNA-Leu
    88. Citrobacter sp. ABFQG tRNA-Leu
    89. Citrobacter sp. B72 tRNA-Leu
    90. Citrobacter sp. BDA59-3 tRNA-Leu
    91. Citrobacter sp. BIDMC107 tRNA-Leu
    92. Citrobacter sp. BIDMC108 tRNA-Leu
    93. Citrobacter sp. C13 tRNA-Leu
    94. Citrobacter sp. C1 tRNA-Leu
    95. Citrobacter sp. C5_2 tRNA-Leu
    96. Citrobacter sp. C6_1 tRNA-Leu
    97. Citrobacter sp. C6_2 tRNA-Leu
    98. Citrobacter sp. CF971 tRNA-Leu
    99. Citrobacter sp. CFNIH10 tRNA-Leu
    100. Citrobacter sp. CRE-46 tRNA-Leu
    101. Citrobacter sp. DNRA3 tRNA-Leu
    102. Citrobacter sp. EC_71 tRNA-Leu
    103. Citrobacter sp. FDAARGOS_156 tRNA-Leu
    104. Citrobacter sp. JL976 tRNA-Leu
    105. Citrobacter sp. JL978 tRNA-Leu
    106. Citrobacter sp. KTE151 tRNA-Leu
    107. Citrobacter sp. KTE30 tRNA-Leu
    108. Citrobacter sp. KTE32 tRNA-Leu
    109. Citrobacter sp. L17 tRNA-Leu
    110. Citrobacter sp. L55 tRNA-Leu
    111. Citrobacter sp. LUTT5 tRNA-Leu
    112. Citrobacter arsenatis tRNA-Leu
    113. Citrobacter sp. MGH100 tRNA-Leu
    114. Citrobacter sp. MGH103 tRNA-Leu
    115. Citrobacter sp. MGH104 tRNA-Leu
    116. Citrobacter sp. MGH105 tRNA-Leu
    117. Citrobacter sp. MGH106 tRNA-Leu
    118. Citrobacter sp. MGH109 tRNA-Leu
    119. Citrobacter sp. MGH110 tRNA-Leu
    120. Citrobacter sp. MGH99 tRNA-Leu
    121. Citrobacter sp. MH181794 tRNA-Leu
    122. Citrobacter telavivensis tRNA-Leu
    123. Citrobacter sp. R56 tRNA-Leu
    124. Citrobacter sp. RHB20-C15 tRNA-Leu
    125. Citrobacter sp. RHB20-C16 tRNA-Leu
    126. Citrobacter sp. RHB21-C01 tRNA-Leu
    127. Citrobacter sp. RHB21-C05 tRNA-Leu
    128. Citrobacter sp. RHB35-C17 tRNA-Leu
    129. Citrobacter sp. RHB35-C21 tRNA-Leu
    130. Citrobacter sp. RHB36-C18 tRNA-Leu
    131. Citrobacter sp. RHBSTW-00013 tRNA-Leu
    132. Citrobacter sp. RHBSTW-00017 tRNA-Leu
    133. Citrobacter sp. RHBSTW-00021 tRNA-Leu
    134. Citrobacter sp. RHBSTW-00029 tRNA-Leu
    135. Citrobacter sp. RHBSTW-00053 tRNA-Leu
    136. Citrobacter sp. RHBSTW-00089 tRNA-Leu
    137. Citrobacter sp. RHBSTW-00104 tRNA-Leu
    138. Citrobacter sp. RHBSTW-00107 tRNA-Leu
    139. Citrobacter sp. RHBSTW-00127 tRNA-Leu
    140. Citrobacter sp. RHBSTW-00137 tRNA-Leu
    141. Citrobacter sp. RHBSTW-00229 tRNA-Leu
    142. Citrobacter sp. RHBSTW-00271 tRNA-Leu
    143. Citrobacter sp. RHBSTW-00325 tRNA-Leu
    144. Citrobacter sp. RHBSTW-00424 tRNA-Leu
    145. Citrobacter sp. RHBSTW-00446 tRNA-Leu
    146. Citrobacter sp. RHBSTW-00509 tRNA-Leu
    147. Citrobacter sp. RHBSTW-00524 tRNA-Leu
    148. Citrobacter sp. RHBSTW-00570 tRNA-Leu
    149. Citrobacter sp. RHBSTW-00599 tRNA-Leu
    150. Citrobacter sp. RHBSTW-00628 tRNA-Leu
    151. Citrobacter sp. RHBSTW-00667 tRNA-Leu
    152. Citrobacter sp. RHBSTW-00671 tRNA-Leu
    153. Citrobacter sp. RHBSTW-00678 tRNA-Leu
    154. Citrobacter sp. RHBSTW-00696 tRNA-Leu
    155. Citrobacter sp. RHBSTW-00821 tRNA-Leu
    156. Citrobacter sp. RHBSTW-00827 tRNA-Leu
    157. Citrobacter sp. RHBSTW-00848 tRNA-Leu
    158. Citrobacter sp. RHBSTW-00859 tRNA-Leu
    159. Citrobacter sp. RHBSTW-00881 tRNA-Leu
    160. Citrobacter sp. RHBSTW-00887 tRNA-Leu
    161. Citrobacter sp. RHBSTW-00903 tRNA-Leu
    162. Citrobacter sp. RHBSTW-00944 tRNA-Leu
    163. Citrobacter sp. RHBSTW-00976 tRNA-Leu
    164. Citrobacter sp. RHBSTW-00986 tRNA-Leu
    165. Citrobacter sp. RHBSTW-01013 tRNA-Leu
    166. Citrobacter sp. RHBSTW-01044 tRNA-Leu
    167. Citrobacter sp. RHBSTW-01065 tRNA-Leu
    168. Citrobacter sp. S39 tRNA-Leu
    169. Citrobacter sp. S46_ASV_140 tRNA-Leu
    170. Citrobacter sp. S55_ASV_140 tRNA-Leu
    171. Citrobacter sp. TBCP-5362 tRNA-Leu
    172. Citrobacter sp. TBCS-11 tRNA-Leu
    173. Citrobacter sp. TBCS-14 tRNA-Leu
    174. Citrobacter sp. TBCS-15 tRNA-Leu
    175. Citrobacter sp. TSA-1 tRNA-Leu
    176. Citrobacter sp. (wastewater metagenome) tRNA-Leu
    177. Citrobacter sp. wls613 tRNA-Leu
    178. Citrobacter sp. wls615 tRNA-Leu
    179. Citrobacter sp. wls617 tRNA-Leu
    180. Citrobacter sp. wls618 tRNA-Leu
    181. Citrobacter sp. wls619 tRNA-Leu
    182. Citrobacter sp. wls620 tRNA-Leu
    183. Citrobacter sp. wls621 tRNA-Leu
    184. Citrobacter sp. wls706 tRNA-Leu
    185. Citrobacter sp. wls707 tRNA-Leu
    186. Citrobacter sp. wls708 tRNA-Leu
    187. Citrobacter sp. wls710 tRNA-Leu
    188. Citrobacter sp. wls711 tRNA-Leu
    189. Citrobacter sp. wls712 tRNA-Leu
    190. Citrobacter sp. wls713 tRNA-Leu
    191. Citrobacter sp. wls714 tRNA-Leu
    192. Citrobacter sp. wls715 tRNA-Leu
    193. Citrobacter sp. wls716 tRNA-Leu
    194. Citrobacter sp. wls717 tRNA-Leu
    195. Citrobacter sp. wls718 tRNA-Leu
    196. Citrobacter sp. wls757 tRNA-Leu
    197. Citrobacter sp. wls758 tRNA-Leu
    198. Citrobacter sp. wls827 tRNA-Leu
    199. Citrobacter sp. wls828 tRNA-Leu
    200. Citrobacter sp. wls829 tRNA-Leu
    201. Citrobacter sp. wls830 tRNA-Leu
    202. Citrobacter sp. wls831 tRNA-Leu
    203. Citrobacter sp. Y3 tRNA-Leu
    204. Citrobacter telavivensis tRNA-Leu
    205. Citrobacter tructae tRNA-Leu
    206. Citrobacter werkmanii NBRC 105721 tRNA-Leu
    207. Citrobacter werkmanii tRNA-Leu
    208. Citrobacter youngae ATCC 29220 tRNA-Leu
    209. Citrobacter youngae tRNA-Leu
    210. compost metagenome tRNA-Leu
    211. Proteus myxofaciens ATCC 19692 tRNA-Leu
    212. Cronobacter condimenti 1330 tRNA-Leu
    213. Cronobacter dublinensis subsp. dublinensis LMG 23823 tRNA-Leu
    214. Cronobacter dublinensis subsp. dublinensis tRNA-Leu
    215. Cronobacter dublinensis tRNA-Leu
    216. Cronobacter malonaticus ENBT0334 tRNA-Leu
    217. Cronobacter malonaticus LMG 23826 tRNA-Leu
    218. Cronobacter malonaticus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    219. Cronobacter muytjensii ATCC 51329 tRNA-Leu
    220. Cronobacter muytjensii tRNA-Leu
    221. Cronobacter sakazakii ATCC BAA-894 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    222. Cronobacter sakazakii E899 tRNA-Leu
    223. Cronobacter sakazakii ES15 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    224. Cronobacter sakazakii SP291 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    225. Cronobacter sakazakii tRNA-Leu(tag)
    226. Cronobacter sp. EKM101R tRNA-Leu
    227. Cronobacter turicensis tRNA-Leu
    228. Cronobacter turicensis z3032 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    229. Cronobacter universalis NCTC 9529 tRNA-Leu
    230. Cronobacter universalis tRNA-Leu(tag)
    231. [Curtobacterium] plantarum tRNA-Leu
    232. Dickeya chrysanthemi Ech1591 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    233. Dickeya chrysanthemi tRNA-Leu
    234. Dickeya dadantii 3937 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    235. Dickeya dadantii tRNA-Leu
    236. Dickeya dianthicola RNS04.9 tRNA-Leu
    237. Dickeya dianthicola tRNA-Leu
    238. Dickeya fangzhongdai tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    239. Dickeya parazeae Ech586 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    240. Dickeya solani D s0432-1 tRNA-Leu
    241. Dickeya solani IPO 2222 tRNA-Leu
    242. Dickeya solani RNS 08.23.3.1.A tRNA-Leu
    243. Dickeya solani tRNA-Leu
    244. Dickeya sp. CFBP 2040 tRNA-Leu
    245. Dickeya undicola tRNA-Leu
    246. Dickeya undicola tRNA-Leu
    247. Dickeya poaceiphila tRNA-Leu
    248. Dickeya sp. ws52 tRNA-Leu
    249. Dickeya zeae EC1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    250. Dickeya zeae tRNA-Leu
    251. Enterobacillus tribolii tRNA-Leu
    252. Tenebrionibacter intestinalis tRNA-Leu
    253. Enterobacterales bacterium CwR94 tRNA-Leu
    254. Enterobacter asburiae L1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    255. Enterobacter asburiae tRNA-Leu(tag)
    256. Enterobacter bugandensis tRNA-Leu(tag)
    257. Enterobacter cancerogenus ATCC 35316 tRNA-Leu
    258. Enterobacter cancerogenus tRNA-Leu(tag)
    259. Enterobacter chengduensis tRNA-Leu
    260. Enterobacter chuandaensis tRNA-Leu
    261. Enterobacter cloacae BIDMC 33A tRNA-Leu
    262. Enterobacter cloacae BIDMC 66 tRNA-Leu
    263. Enterobacter cloacae BIDMC 67 tRNA-Leu
    264. Enterobacter cloacae BIDMC 8 tRNA-Leu
    265. Enterobacter cloacae BWH 29 tRNA-Leu
    266. Enterobacter cloacae BWH 31 tRNA-Leu
    267. Enterobacter cloacae BWH 43 tRNA-Leu
    268. Enterobacter cloacae complex sp. 2DZ2F16B1 tRNA-Leu
    269. Enterobacter cloacae complex sp. 2DZ2F20B tRNA-Leu
    270. Enterobacter cloacae complex sp. 2DZ2F2B tRNA-Leu
    271. Enterobacter cloacae complex sp. 3DZ3S2B tRNA-Leu
    272. Enterobacter cloacae complex sp. 4DZ1-17B1 tRNA-Leu
    273. Enterobacter cloacae complex sp. 4DZ3-17B2 tRNA-Leu
    274. Enterobacter cloacae complex sp. 4DZ3-28B tRNA-Leu
    275. Enterobacter cloacae complex sp. 677-3DZ2D5B tRNA-Leu
    276. Enterobacter cloacae complex sp. 742-ADZ3-9B tRNA-Leu
    277. Enterobacter cloacae complex sp. 743-2DZ2F-22B tRNA-Leu
    278. Enterobacter cloacae complex sp. CH23B tRNA-Leu
    279. Enterobacter cloacae complex sp. ECNIH10 tRNA-Leu
    280. Enterobacter cloacae complex sp. ECNIH11 tRNA-Leu
    281. Enterobacter cloacae complex sp. ECNIH12 tRNA-Leu
    282. Enterobacter cloacae complex sp. ECNIH13 tRNA-Leu
    283. Enterobacter cloacae complex sp. ECNIH14 tRNA-Leu
    284. Enterobacter cloacae complex sp. ECNIH15 tRNA-Leu
    285. Enterobacter cloacae complex sp. ECNIH16 tRNA-Leu
    286. Enterobacter cloacae complex sp. ECNIH17 tRNA-Leu
    287. Enterobacter cloacae complex sp. ECNIH6 tRNA-Leu
    288. Enterobacter cloacae complex sp. ECNIH7 tRNA-Leu
    289. Enterobacter cloacae complex sp. ECNIH8 tRNA-Leu
    290. Enterobacter cloacae complex sp. ECNIH9 tRNA-Leu
    291. Enterobacter cloacae complex sp. FDA-CDC-AR_0132 tRNA-Leu
    292. Enterobacter cloacae complex sp. FDA-CDC-AR_0164 tRNA-Leu
    293. Enterobacter cloacae complex sp. GF14B tRNA-Leu
    294. Enterobacter cloacae complex sp. I10 tRNA-Leu
    295. Enterobacter cloacae complex sp. I11 tRNA-Leu
    296. Enterobacter cloacae complex sp. I1 tRNA-Leu
    297. Enterobacter cloacae complex sp. I2 tRNA-Leu
    298. Enterobacter cloacae complex sp. I4 tRNA-Leu
    299. Enterobacter cloacae complex sp. I5 tRNA-Leu
    300. Enterobacter cloacae complex sp. I6 tRNA-Leu
    301. Enterobacter cloacae complex sp. I7 tRNA-Leu
    302. Enterobacter cloacae complex sp. I8 tRNA-Leu
    303. Enterobacter cloacae complex sp. I9 tRNA-Leu
    304. Enterobacter cloacae complex sp. P14RS tRNA-Leu
    305. Enterobacter cloacae complex sp. P15RS tRNA-Leu
    306. Enterobacter cloacae complex sp. P17RS tRNA-Leu
    307. Enterobacter cloacae complex sp. P20B tRNA-Leu
    308. Enterobacter cloacae complex sp. P20C tRNA-Leu
    309. Enterobacter cloacae complex sp. P21C tRNA-Leu
    310. Enterobacter cloacae complex sp. P21RS tRNA-Leu
    311. Enterobacter cloacae complex sp. P22RS tRNA-Leu
    312. Enterobacter cloacae complex sp. P23RS tRNA-Leu
    313. Enterobacter cloacae complex sp. P25RS tRNA-Leu
    314. Enterobacter cloacae complex sp. P26RS tRNA-Leu
    315. Enterobacter cloacae complex sp. P27C tRNA-Leu
    316. Enterobacter cloacae complex sp. P28RS tRNA-Leu
    317. Enterobacter cloacae complex sp. P29RS tRNA-Leu
    318. Enterobacter cloacae complex sp. P2B tRNA-Leu
    319. Enterobacter cloacae complex sp. P30BA tRNA-Leu
    320. Enterobacter cloacae complex sp. P30U tRNA-Leu
    321. Enterobacter cloacae complex sp. P31C tRNA-Leu
    322. Enterobacter cloacae complex sp. P32C tRNA-Leu
    323. Enterobacter cloacae complex sp. P33B tRNA-Leu
    324. Enterobacter cloacae complex sp. P34C tRNA-Leu
    325. Enterobacter cloacae complex sp. P40C2 tRNA-Leu
    326. Enterobacter cloacae complex sp. P42C tRNA-Leu
    327. Enterobacter cloacae complex sp. P43RS tRNA-Leu
    328. Enterobacter cloacae complex sp. P44RS tRNA-Leu
    329. Enterobacter cloacae complex sp. P47BA tRNA-Leu
    330. Enterobacter cloacae complex sp. P6RS tRNA-Leu
    331. Enterobacter cloacae complex sp. P8BA tRNA-Leu
    332. Enterobacter cloacae complex sp. P9RS tRNA-Leu
    333. Enterobacter cloacae complex sp. TREC1 tRNA-Leu
    334. Enterobacter cloacae complex sp. tRNA-Leu
    335. Enterobacter cloacae ECNIH2 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    336. Enterobacter cloacae MGH 53 tRNA-Leu
    337. Enterobacter cloacae MRSN 11489 tRNA-Leu
    338. Enterobacter cloacae S611 tRNA-Leu
    339. Enterobacter cloacae str. Hanford tRNA-Leu
    340. Enterobacter cloacae subsp. cloacae ATCC 13047 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    341. Enterobacter cloacae subsp. cloacae NCTC 9394 tRNA Leucine with anticodon TAG (tRNA-Leu-TAG-1-1)
    342. Enterobacter cloacae subsp. cloacae tRNA-Leu
    343. Enterobacter cloacae subsp. dissolvens SDM tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    344. Enterobacter cloacae subsp. dissolvens tRNA-Leu
    345. Enterobacter cloacae tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    346. Enterobacter cloacae UCI 23 tRNA-Leu
    347. Enterobacter cloacae UCI 24 tRNA-Leu
    348. Enterobacter cloacae UCI 29 tRNA-Leu
    349. Enterobacter cloacae UCI 30 tRNA-Leu
    350. Enterobacter cloacae UCI 35 tRNA-Leu
    351. Enterobacter cloacae UCI 36 tRNA-Leu
    352. Enterobacter cloacae UCI 49 tRNA-Leu
    353. Enterobacter cloacae UCICRE 11 tRNA-Leu
    354. Enterobacter cloacae UCICRE 12 tRNA-Leu
    355. Enterobacter cloacae UCICRE 5 tRNA-Leu
    356. Enterobacter hormaechei ATCC 49162 tRNA-Leu
    357. Enterobacter hormaechei subsp. hoffmannii ECNIH3 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    358. Enterobacter hormaechei subsp. hoffmannii ECR091 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    359. Enterobacter hormaechei subsp. hoffmannii MGH 13 tRNA-Leu
    360. Enterobacter hormaechei subsp. hoffmannii MRSN 11248 tRNA-Leu
    361. Enterobacter hormaechei subsp. hoffmannii tRNA-Leu
    362. Enterobacter hormaechei subsp. hoffmannii UCI 50 tRNA-Leu
    363. Enterobacter hormaechei subsp. hoffmannii UCICRE 3 tRNA-Leu
    364. Enterobacter hormaechei subsp. hoffmannii UCICRE 9 tRNA-Leu
    365. Enterobacter hormaechei subsp. hormaechei tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    366. Enterobacter hormaechei subsp. oharae tRNA-Leu
    367. Enterobacter hormaechei subsp. steigerwaltii tRNA-Leu
    368. Enterobacter hormaechei subsp. xiangfangensis tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    369. Enterobacter hormaechei tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    370. Enterobacter huaxiensis tRNA-Leu
    371. Enterobacteriaceae bacterium 4M9 tRNA-Leu
    372. Enterobacteriaceae bacterium 8376wB8 tRNA-Leu
    373. Enterobacteriaceae bacterium 8376wB9 tRNA-Leu
    374. Enterobacteriaceae bacterium 8376wD7 tRNA-Leu
    375. Enterobacteriaceae bacterium 8376wD8 tRNA-Leu
    376. Enterobacteriaceae bacterium 8376wD9 tRNA-Leu
    377. Enterobacteriaceae bacterium 8376wG6 tRNA-Leu
    378. Enterobacteriaceae bacterium 8376wH8 tRNA-Leu
    379. Enterobacteriaceae bacterium A-F18 tRNA-Leu
    380. Enterobacteriaceae bacterium ATCC 29904 tRNA-Leu
    381. Enterobacteriaceae bacterium BIT-l23 tRNA-Leu
    382. Enterobacteriaceae bacterium EKM102V tRNA-Leu
    383. Enterobacteriaceae bacterium ENNIH1 tRNA-Leu
    384. Enterobacteriaceae bacterium ENNIH2 tRNA-Leu
    385. Enterobacteriaceae bacterium ENNIH3 tRNA-Leu
    386. Enterobacteriaceae bacterium RIT691 tRNA-Leu
    387. Enterobacteriaceae bacterium RIT693 tRNA-Leu
    388. Enterobacteriaceae bacterium RIT711 tRNA-Leu
    389. Enterobacteriaceae bacterium RIT714 tRNA-Leu
    390. Enterobacteriaceae bacterium S05 tRNA-Leu
    391. Enterobacteriaceae bacterium S29_ASV_15 tRNA-Leu
    392. Enterobacteriaceae bacterium strain FGI 57 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    393. Enterobacteriaceae bacterium tRNA-Leu
    394. Enterobacteriaceae bacterium TzEc013 tRNA-Leu
    395. Enterobacteriaceae bacterium TzEc051 tRNA-Leu
    396. Enterobacteriaceae bacterium TzEc058 tRNA-Leu
    397. Enterobacteriaceae bacterium TzEc077 tRNA-Leu
    398. Enterobacteriaceae bacterium TzEc084 tRNA-Leu
    399. Enterobacteriaceae bacterium YMB-R21 tRNA-Leu
    400. Acerihabitans arboris tRNA-Leu
    401. Enterobacter kobei tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    402. [Enterobacter] lignolyticus SCF1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    403. [Enterobacter] lignolyticus tRNA-Leu
    404. Enterobacter ludwigii tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    405. Enterobacter mori tRNA-Leu
    406. Enterobacter roggenkampii CHS 79 tRNA-Leu
    407. Enterobacter roggenkampii EC_38VIM1 tRNA-Leu
    408. Enterobacter roggenkampii MGH 34 tRNA-Leu
    409. Enterobacter roggenkampii MGH 54 tRNA-Leu
    410. Enterobacter roggenkampii tRNA-Leu
    411. Enterobacter roggenkampii UCI 39 tRNA-Leu
    412. Enterobacter sichuanensis tRNA-Leu
    413. Enterobacter soli ATCC BAA-2102 tRNA-Leu
    414. Enterobacter soli tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    415. Enterobacter sp. 10-1 tRNA-Leu
    416. Enterobacter sp. 18A13 tRNA-Leu
    417. Enterobacter sp. 198 tRNA-Leu
    418. Enterobacter sp. 301B tRNA-Leu
    419. Enterobacter sp. 50588862 tRNA-Leu
    420. Enterobacter sp. 50793107 tRNA-Leu
    421. Enterobacter sp. 50858885 tRNA-Leu
    422. Enterobacter sp. 56-7 tRNA-Leu
    423. Enterobacter sp. 638 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    424. Enterobacter sp. 9-2 tRNA-Leu
    425. Enterobacter sp. A11 tRNA-Leu
    426. Enterobacter sp. AD2-3 tRNA-Leu
    427. Enterobacter sp. Ag1 tRNA-Leu
    428. Enterobacter sp. AM17-18 tRNA-Leu
    429. Enterobacter sp. Ap-916 tRNA-Leu
    430. Enterobacter sp. AS-1 tRNA-Leu
    431. Enterobacter sp. BIDMC100 tRNA-Leu
    432. Enterobacter sp. BIDMC109 tRNA-Leu
    433. Enterobacter sp. BIDMC110 tRNA-Leu
    434. Enterobacter sp. BIDMC 26 tRNA-Leu
    435. Enterobacter sp. BIDMC 27 tRNA-Leu
    436. Enterobacter sp. BIDMC 28 tRNA-Leu
    437. Enterobacter sp. BIDMC 29 tRNA-Leu
    438. Enterobacter sp. BIDMC 30 tRNA-Leu
    439. Enterobacter sp. BIDMC87 tRNA-Leu
    440. Enterobacter sp. BIDMC92 tRNA-Leu
    441. Enterobacter sp. BIDMC93 tRNA-Leu
    442. Enterobacter sp. BIDMC94 tRNA-Leu
    443. Enterobacter sp. BIDMC99 tRNA-Leu
    444. Enterobacter sp. BWH 27 tRNA-Leu
    445. Enterobacter sp. BWH 37 tRNA-Leu
    446. Enterobacter sp. BWH 39 tRNA-Leu
    447. Enterobacter sp. BWH52 tRNA-Leu
    448. Enterobacter sp. BWH63 tRNA-Leu
    449. Enterobacter sp. BWH64 tRNA-Leu
    450. Enterobacter sp. C6 tRNA-Leu
    451. Enterobacter sp. CC120223-11 tRNA_Leu_TAG
    452. Enterobacter sp. Crenshaw tRNA-Leu
    453. Enterobacter sp. CRENT-193 tRNA-Leu
    454. Enterobacter sp. DC1 tRNA-Leu
    455. Enterobacter sp. DC3 tRNA-Leu
    456. Enterobacter sp. DC4 tRNA-Leu
    457. Enterobacter sp. DNRA5 tRNA-Leu
    458. unidentified tRNA-Leu
    459. Enterobacter sp. E12 tRNA-Leu
    460. Enterobacter sp. E20 tRNA-Leu
    461. Enterobacter sp. E76 tRNA-Leu
    462. Enterobacter sp. EA-1 tRNA-Leu
    463. Enterobacter sp. EC_62 tRNA-Leu
    464. Enterobacter sp. EC-NT1 tRNA-Leu
    465. Enterobacter sp. EGD-HP1 tRNA-Leu
    466. Enterobacter sp. ENT02 tRNA-Leu
    467. Enterobacter sp. FB tRNA-Leu
    468. Enterobacter sp. FS01 tRNA-Leu
    469. Enterobacter sp. FY-07 tRNA-Leu
    470. Enterobacter sp. HK169 tRNA-Leu
    471. Enterobacter sp. HMSC055A11 tRNA-Leu
    472. Enterobacter sp. HMSC16D10 tRNA-Leu
    473. Enterobacter sp. HN503E2II tRNA-Leu
    474. Enterobacter sp. HPCN14 tRNA-Leu
    475. Enterobacter sp. J49 tRNA-Leu
    476. Enterobacter sp. JGM127 tRNA-Leu
    477. Enterobacter sp. JUb54 tRNA-Leu
    478. Enterobacter sp. K66-74 tRNA-Leu
    479. Enterobacter sp. kpr-6 tRNA_Leu_TAG
    480. Enterobacter sp. ku-bf2 tRNA-Leu
    481. Enterobacter sp. LU1 tRNA-Leu
    482. Enterobacter sp. M4-VN tRNA-Leu
    483. Enterobacter sp. MF024 tRNA-Leu
    484. Enterobacter sp. MGH 10 tRNA-Leu
    485. Enterobacter sp. MGH119 tRNA-Leu
    486. Enterobacter sp. MGH 11 tRNA-Leu
    487. Enterobacter sp. MGH120 tRNA-Leu
    488. Enterobacter sp. MGH127 tRNA-Leu
    489. Enterobacter sp. MGH128 tRNA-Leu
    490. Enterobacter sp. MGH 12 tRNA-Leu
    491. Enterobacter sp. MGH 14 tRNA-Leu
    492. Enterobacter sp. MGH 15 tRNA-Leu
    493. Enterobacter sp. MGH 16 tRNA-Leu
    494. Enterobacter sp. MGH 1 tRNA-Leu
    495. Enterobacter sp. MGH 22 tRNA-Leu
    496. Enterobacter sp. MGH 23 tRNA-Leu
    497. Enterobacter sp. MGH 24 tRNA-Leu
    498. Enterobacter sp. MGH 25 tRNA-Leu
    499. Enterobacter sp. MGH 26 tRNA-Leu
    500. Enterobacter sp. MGH 2 tRNA-Leu
    501. Enterobacter sp. MGH 33 tRNA-Leu
    502. Enterobacter sp. MGH 37 tRNA-Leu
    503. Enterobacter sp. MGH 38 tRNA-Leu
    504. Enterobacter sp. MGH 3 tRNA-Leu
    505. Enterobacter sp. MGH 4 tRNA-Leu
    506. Enterobacter sp. MGH 5 tRNA-Leu
    507. Enterobacter sp. MGH 6 tRNA-Leu
    508. Enterobacter sp. MGH 7 tRNA-Leu
    509. Enterobacter sp. MGH85 tRNA-Leu
    510. Enterobacter sp. MGH86 tRNA-Leu
    511. Enterobacter sp. MGH 8 tRNA-Leu
    512. Enterobacter sp. MGH 9 tRNA-Leu
    513. Enterobacter sp. N18-03635 tRNA-Leu
    514. Enterobacter sp. NFIX58 tRNA_Leu_TAG
    515. Enterobacter sp. NFIX59 tRNA_Leu_TAG
    516. Enterobacter sp. NFR05 tRNA_Leu_TAG
    517. Enterobacter sp. ODB01 tRNA-Leu
    518. Enterobacter sp. OLF tRNA-Leu
    519. Enterobacter sp. PN108E5IIB tRNA-Leu
    520. Enterobacter sp. R1(2018) tRNA-Leu
    521. Enterobacter sp. R4-368 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    522. Enterobacter sp. RC4 tRNA-Leu
    523. Enterobacter sp. RHB15-C17 tRNA-Leu
    524. Enterobacter sp. RHBSTW-00131 tRNA-Leu
    525. Enterobacter sp. RHBSTW-00175 tRNA-Leu
    526. Enterobacter sp. RHBSTW-00318 tRNA-Leu
    527. Enterobacter sp. RHBSTW-00340 tRNA-Leu
    528. Enterobacter sp. RHBSTW-00422 tRNA-Leu
    529. Enterobacter sp. RHBSTW-00593 tRNA-Leu
    530. Enterobacter sp. RHBSTW-00901 tRNA-Leu
    531. Enterobacter sp. RHBSTW-00974 tRNA-Leu
    532. Enterobacter sp. RHBSTW-00975 tRNA-Leu
    533. Enterobacter sp. RHBSTW-00994 tRNA-Leu
    534. Enterobacter sp. RHBSTW-01064 tRNA-Leu
    535. Enterobacter sp. RIT 418 tRNA-Leu
    536. Enterobacter sp. RIT637 tRNA-Leu
    537. Enterobacter sp. RJAL6 tRNA-Leu
    538. Enterobacter sp. SECR18-0236 tRNA-Leu
    539. Enterobacter sp. SECR19-1250 tRNA-Leu
    540. Enterobacter sp. SENG-6 tRNA-Leu
    541. Enterobacter sp. SES19 tRNA-Leu
    542. Enterobacter sp. SST3 tRNA-Leu
    543. Enterobacter sp. ST121:950178628 tRNA-Leu
    544. Enterobacter sp. T2 tRNA-Leu
    545. Enterobacter sp. TF2-1-2 tRNA-Leu
    546. Enterobacter sp. TF5 tRNA-Leu
    547. Enterobacter sp. UCD-UG_FMILLET tRNA-Leu
    548. Enterobacter sp. tRNA-Leu
    549. Enterobacter sp. WCHEn045836 tRNA-Leu
    550. Enterobacter sp. WCHEn090032 tRNA-Leu
    551. Enterobacter quasiroggenkampii tRNA-Leu
    552. Enterobacter wuhouensis tRNA-Leu
    553. Enterobacter quasihormaechei tRNA-Leu
    554. Enterobacter sp. YSU tRNA-Leu
    555. Enterobacter sp. Z1 tRNA-Leu
    556. Enterococcus durans tRNA-Leu
    557. Enterococcus sp. HPCN38 tRNA-Leu
    558. Erwinia amylovora 01SFR-BO tRNA-Leu
    559. Erwinia amylovora ACW56400 tRNA-Leu
    560. Erwinia amylovora ATCC 49946 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    561. Erwinia amylovora NBRC 12687 = CFBP 1232 tRNA-Leu
    562. Erwinia amylovora CFBP1430 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    563. Erwinia amylovora CFBP 2585 tRNA-Leu
    564. Erwinia amylovora Ea266 tRNA-Leu
    565. Erwinia amylovora Ea356 tRNA-Leu
    566. Erwinia amylovora Ea644 tRNA-Leu
    567. Erwinia amylovora MR1 tRNA-Leu
    568. Erwinia amylovora NBRC 12687 = CFBP 1232 tRNA-Leu
    569. Erwinia amylovora tRNA-Leu
    570. Erwinia amylovora UPN527 tRNA-Leu
    571. Erwinia aphidicola tRNA-Leu
    572. Erwinia billingiae Eb661 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    573. Erwinia billingiae transfer RNA-Leu
    574. Kalamiella piersonii tRNA-Leu
    575. Erwiniaceae bacterium PD-1 tRNA-Leu
    576. Erwinia gerundensis tRNA-Leu
    577. Erwinia iniecta tRNA-Leu
    578. Erwinia mallotivora tRNA-Leu
    579. Erwinia persicina tRNA-Leu
    580. Erwinia piriflorinigrans CFBP 5888 tRNA-Leu
    581. Erwinia psidii tRNA-Leu
    582. Erwinia pyrifoliae DSM 12163 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    583. Erwinia pyrifoliae Ep1/96 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    584. Erwinia pyrifoliae transfer RNA-Leu
    585. Erwinia rhapontici tRNA-Leu
    586. Erwinia sp. 198 tRNA-Leu
    587. Erwinia sp. B116 tRNA-Leu
    588. Erwinia sp. CPCC 100877 tRNA-Leu
    589. Erwinia sp. E602 tRNA-Leu
    590. Erwinia sp. Ejp617 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    591. Erwinia sp. J316 tRNA-Leu
    592. Erwinia sp. J780 tRNA-Leu
    593. Erwinia sp. JH02 tRNA-Leu
    594. Erwinia sp. Leaf53 tRNA-Leu
    595. Erwinia sp. OAMSP11 tRNA-Leu
    596. Erwinia sp. OLCASP19 tRNA-Leu
    597. Erwinia sp. OLFS4 tRNA-Leu
    598. Erwinia sp. OLMDLW33 tRNA-Leu
    599. Erwinia sp. OLMDSP33 tRNA-Leu
    600. Erwinia sp. OLMTSP26 tRNA-Leu
    601. Erwinia sp. OLSSP12 tRNA-Leu
    602. Erwinia sp. OLTSP20 tRNA-Leu
    603. Erwinia sp. QL-Z3 tRNA-Leu
    604. Erwinia sp. S38 tRNA-Leu
    605. Erwinia tasmaniensis Et1/99 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    606. Erwinia tasmaniensis transfer RNA-Leu
    607. Erwinia tracheiphila PSU-1 tRNA-Leu
    608. Erwinia tracheiphila tRNA-Leu
    609. Erwinia typographi tRNA-Leu
    610. Escherichia alba tRNA-Leu
    611. Escherichia albertii B156 tRNA-Leu
    612. Escherichia albertii KF1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    613. Escherichia albertii tRNA-Leu
    614. Escherichia coli 0.1288 tRNA-Leu
    615. Escherichia coli 0.1304 tRNA-Leu
    616. Escherichia coli 042 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    617. Escherichia coli 07798 tRNA-Leu
    618. Escherichia coli 08BKT055439 tRNA-Leu
    619. Escherichia coli 08BKT77219 tRNA-Leu
    620. Escherichia coli 09BKT024447 tRNA-Leu
    621. Escherichia coli 09BKT076207 tRNA-Leu
    622. Escherichia coli 09BKT078844 tRNA-Leu
    623. Escherichia coli 10.0821 tRNA-Leu
    624. Escherichia coli 10.0833 tRNA-Leu
    625. Escherichia coli 10.0869 tRNA-Leu
    626. Escherichia coli 110957 tRNA-Leu
    627. Escherichia coli 1-110-08_S1_C1 tRNA-Leu
    628. Escherichia coli 1-110-08_S1_C2 tRNA-Leu
    629. Escherichia coli 1-110-08_S1_C3 tRNA-Leu
    630. Escherichia coli 1-110-08_S3_C1 tRNA-Leu
    631. Escherichia coli 1-110-08_S3_C2 tRNA-Leu
    632. Escherichia coli 1-110-08_S3_C3 tRNA-Leu
    633. Escherichia coli 1-110-08_S4_C1 tRNA-Leu
    634. Escherichia coli 1-110-08_S4_C2 tRNA-Leu
    635. Escherichia coli 1-110-08_S4_C3 tRNA-Leu
    636. Escherichia coli 113290 tRNA-Leu
    637. Escherichia coli 113302 tRNA-Leu
    638. Escherichia coli 113303 tRNA-Leu
    639. Escherichia coli 1-176-05_S1_C1 tRNA-Leu
    640. Escherichia coli 1-176-05_S1_C2 tRNA-Leu
    641. Escherichia coli 1-176-05_S1_C3 tRNA-Leu
    642. Escherichia coli 1-176-05_S3_C1 tRNA-Leu
    643. Escherichia coli 1-176-05_S3_C2 tRNA-Leu
    644. Escherichia coli 1-176-05_S4_C1 tRNA-Leu
    645. Escherichia coli 1-176-05_S4_C2 tRNA-Leu
    646. Escherichia coli 1-176-05_S4_C3 tRNA-Leu
    647. Escherichia coli 1-182-04_S1_C1 tRNA-Leu
    648. Escherichia coli 1-182-04_S1_C2 tRNA-Leu
    649. Escherichia coli 1-182-04_S1_C3 tRNA-Leu
    650. Escherichia coli 1-182-04_S3_C1 tRNA-Leu
    651. Escherichia coli 1-182-04_S3_C2 tRNA-Leu
    652. Escherichia coli 1-182-04_S3_C3 tRNA-Leu
    653. Escherichia coli 1-182-04_S4_C1 tRNA-Leu
    654. Escherichia coli 1-182-04_S4_C2 tRNA-Leu
    655. Escherichia coli 1-182-04_S4_C3 tRNA-Leu
    656. Escherichia coli 1.2264 tRNA-Leu
    657. Escherichia coli 1-250-04_S1_C1 tRNA-Leu
    658. Escherichia coli 1-250-04_S1_C2 tRNA-Leu
    659. Escherichia coli 1-250-04_S1_C3 tRNA-Leu
    660. Escherichia coli 1-250-04_S3_C1 tRNA-Leu
    661. Escherichia coli 1-250-04_S3_C2 tRNA-Leu
    662. Escherichia coli 1-250-04_S4_C1 tRNA-Leu
    663. Escherichia coli 1-250-04_S4_C2 tRNA-Leu
    664. Escherichia coli 1.2741 tRNA-Leu
    665. Escherichia coli 1303 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    666. Escherichia coli 1-392-07_S1_C1 tRNA-Leu
    667. Escherichia coli 1-392-07_S1_C2 tRNA-Leu
    668. Escherichia coli 1-392-07_S3_C1 tRNA-Leu
    669. Escherichia coli 1-392-07_S3_C2 tRNA-Leu
    670. Escherichia coli 1-392-07_S3_C3 tRNA-Leu
    671. Escherichia coli 1-392-07_S4_C1 tRNA-Leu
    672. Escherichia coli 1-392-07_S4_C2 tRNA-Leu
    673. Escherichia coli 1-392-07_S4_C3 tRNA-Leu
    674. Escherichia coli 14A tRNA-Leu
    675. Escherichia coli 174750 tRNA-Leu
    676. Escherichia coli 174900 tRNA-Leu
    677. Escherichia coli 178200 tRNA-Leu
    678. Escherichia coli 178850 tRNA-Leu
    679. Escherichia coli 178900 tRNA-Leu
    680. Escherichia coli 179100 tRNA-Leu
    681. Escherichia coli 179550 tRNA-Leu
    682. Escherichia coli 180050 tRNA-Leu
    683. Escherichia coli 180200 tRNA-Leu
    684. Escherichia coli 180600 tRNA-Leu
    685. Escherichia coli 1827-70 tRNA-Leu
    686. Escherichia coli 199900.1 tRNA-Leu
    687. Escherichia coli 2-005-03_S1_C1 tRNA-Leu
    688. Escherichia coli 2-005-03_S1_C2 tRNA-Leu
    689. Escherichia coli 2-005-03_S1_C3 tRNA-Leu
    690. Escherichia coli 2-005-03_S3_C1 tRNA-Leu
    691. Escherichia coli 2-005-03_S3_C2 tRNA-Leu
    692. Escherichia coli 2-005-03_S3_C3 tRNA-Leu
    693. Escherichia coli 2-005-03_S4_C1 tRNA-Leu
    694. Escherichia coli 2-005-03_S4_C2 tRNA-Leu
    695. Escherichia coli 2-005-03_S4_C3 tRNA-Leu
    696. Escherichia coli 2-011-08_S1_C1 tRNA-Leu
    697. Escherichia coli 2-011-08_S1_C2 tRNA-Leu
    698. Escherichia coli 2-011-08_S1_C3 tRNA-Leu
    699. Escherichia coli 2-011-08_S3_C1 tRNA-Leu
    700. Escherichia coli 2-011-08_S3_C2 tRNA-Leu
    701. Escherichia coli 2-011-08_S3_C3 tRNA-Leu
    702. Escherichia coli 2-011-08_S4_C1 tRNA-Leu
    703. Escherichia coli 2-011-08_S4_C3 tRNA-Leu
    704. Escherichia coli 201600.1 tRNA-Leu
    705. Escherichia coli 2-052-05_S1_C1 tRNA-Leu
    706. Escherichia coli 2-052-05_S1_C3 tRNA-Leu
    707. Escherichia coli 2-052-05_S3_C1 tRNA-Leu
    708. Escherichia coli 2-052-05_S3_C2 tRNA-Leu
    709. Escherichia coli 2-052-05_S3_C3 tRNA-Leu
    710. Escherichia coli 2-052-05_S4_C1 tRNA-Leu
    711. Escherichia coli 2-052-05_S4_C2 tRNA-Leu
    712. Escherichia coli 2-052-05_S4_C3 tRNA-Leu
    713. Escherichia coli 2-156-04_S1_C3 tRNA-Leu
    714. Escherichia coli 2-156-04_S3_C1 tRNA-Leu
    715. Escherichia coli 2-156-04_S3_C2 tRNA-Leu
    716. Escherichia coli 2-156-04_S3_C3 tRNA-Leu
    717. Escherichia coli 2-156-04_S4_C1 tRNA-Leu
    718. Escherichia coli 2-156-04_S4_C2 tRNA-Leu
    719. Escherichia coli 2-156-04_S4_C3 tRNA-Leu
    720. Escherichia coli 2-177-06_S1_C1 tRNA-Leu
    721. Escherichia coli 2-177-06_S1_C2 tRNA-Leu
    722. Escherichia coli 2-177-06_S1_C3 tRNA-Leu
    723. Escherichia coli 2-177-06_S3_C1 tRNA-Leu
    724. Escherichia coli 2-177-06_S3_C2 tRNA-Leu
    725. Escherichia coli 2-177-06_S3_C3 tRNA-Leu
    726. Escherichia coli 2-177-06_S4_C1 tRNA-Leu
    727. Escherichia coli 2-177-06_S4_C2 tRNA-Leu
    728. Escherichia coli 2-177-06_S4_C3 tRNA-Leu
    729. Escherichia coli 2-210-07_S1_C2 tRNA-Leu
    730. Escherichia coli 2-210-07_S1_C3 tRNA-Leu
    731. Escherichia coli 2-210-07_S3_C1 tRNA-Leu
    732. Escherichia coli 2-210-07_S3_C2 tRNA-Leu
    733. Escherichia coli 2-210-07_S3_C3 tRNA-Leu
    734. Escherichia coli 2-210-07_S4_C1 tRNA-Leu
    735. Escherichia coli 2-210-07_S4_C2 tRNA-Leu
    736. Escherichia coli 2-210-07_S4_C3 tRNA-Leu
    737. Escherichia coli 2-222-05_S1_C1 tRNA-Leu
    738. Escherichia coli 2-222-05_S1_C2 tRNA-Leu
    739. Escherichia coli 2-222-05_S1_C3 tRNA-Leu
    740. Escherichia coli 2-222-05_S3_C1 tRNA-Leu
    741. Escherichia coli 2-222-05_S3_C2 tRNA-Leu
    742. Escherichia coli 2-222-05_S3_C3 tRNA-Leu
    743. Escherichia coli 2-222-05_S4_C1 tRNA-Leu
    744. Escherichia coli 2-222-05_S4_C2 tRNA-Leu
    745. Escherichia coli 2-222-05_S4_C3 tRNA-Leu
    746. Escherichia coli 2-316-03_S1_C1 tRNA-Leu
    747. Escherichia coli 2-316-03_S1_C2 tRNA-Leu
    748. Escherichia coli 2-316-03_S3_C1 tRNA-Leu
    749. Escherichia coli 2-316-03_S3_C2 tRNA-Leu
    750. Escherichia coli 2-316-03_S3_C3 tRNA-Leu
    751. Escherichia coli 2-316-03_S4_C1 tRNA-Leu
    752. Escherichia coli 2-316-03_S4_C2 tRNA-Leu
    753. Escherichia coli 2-316-03_S4_C3 tRNA-Leu
    754. Escherichia coli 2362-75 tRNA-Leu
    755. Escherichia coli 2.3916 tRNA-Leu
    756. Escherichia coli 2.4168 tRNA-Leu
    757. Escherichia coli 2-427-07_S1_C1 tRNA-Leu
    758. Escherichia coli 2-427-07_S1_C2 tRNA-Leu
    759. Escherichia coli 2-427-07_S1_C3 tRNA-Leu
    760. Escherichia coli 2-427-07_S3_C1 tRNA-Leu
    761. Escherichia coli 2-427-07_S3_C3 tRNA-Leu
    762. Escherichia coli 2-427-07_S4_C1 tRNA-Leu
    763. Escherichia coli 2-427-07_S4_C2 tRNA-Leu
    764. Escherichia coli 2-427-07_S4_C3 tRNA-Leu
    765. Escherichia coli 2-460-02_S1_C1 tRNA-Leu
    766. Escherichia coli 2-460-02_S1_C2 tRNA-Leu
    767. Escherichia coli 2-460-02_S1_C3 tRNA-Leu
    768. Escherichia coli 2-460-02_S3_C1 tRNA-Leu
    769. Escherichia coli 2-460-02_S3_C2 tRNA-Leu
    770. Escherichia coli 2-460-02_S3_C3 tRNA-Leu
    771. Escherichia coli 2-460-02_S4_C1 tRNA-Leu
    772. Escherichia coli 2-460-02_S4_C2 tRNA-Leu
    773. Escherichia coli 2-460-02_S4_C3 tRNA-Leu
    774. Escherichia coli 2-474-04_S1_C1 tRNA-Leu
    775. Escherichia coli 2-474-04_S1_C2 tRNA-Leu
    776. Escherichia coli 2-474-04_S3_C1 tRNA-Leu
    777. Escherichia coli 2-474-04_S3_C2 tRNA-Leu
    778. Escherichia coli 2-474-04_S3_C3 tRNA-Leu
    779. Escherichia coli 2-474-04_S4_C1 tRNA-Leu
    780. Escherichia coli 2-474-04_S4_C2 tRNA-Leu
    781. Escherichia coli 2-474-04_S4_C3 tRNA-Leu
    782. Escherichia coli 2534-86 tRNA-Leu
    783. Escherichia coli 2719100 tRNA-Leu
    784. Escherichia coli 2720900 tRNA-Leu
    785. Escherichia coli 2722950 tRNA-Leu
    786. Escherichia coli 2726800 tRNA-Leu
    787. Escherichia coli 2726950 tRNA-Leu
    788. Escherichia coli 2729250 tRNA-Leu
    789. Escherichia coli 2730350 tRNA-Leu
    790. Escherichia coli 2730450 tRNA-Leu
    791. Escherichia coli 2731150 tRNA-Leu
    792. Escherichia coli 2733950 tRNA-Leu
    793. Escherichia coli 2735000 tRNA-Leu
    794. Escherichia coli 2741950 tRNA-Leu
    795. Escherichia coli 2749250 tRNA-Leu
    796. Escherichia coli 2756500 tRNA-Leu
    797. Escherichia coli 2762100 tRNA-Leu
    798. Escherichia coli 2770900 tRNA-Leu
    799. Escherichia coli 2780750 tRNA-Leu
    800. Escherichia coli 2785200 tRNA-Leu
    801. Escherichia coli 2788150 tRNA-Leu
    802. Escherichia coli 2845350 tRNA-Leu
    803. Escherichia coli 2845650 tRNA-Leu
    804. Escherichia coli 2846750 tRNA-Leu
    805. Escherichia coli 2848050 tRNA-Leu
    806. Escherichia coli 2850400 tRNA-Leu
    807. Escherichia coli 2850750 tRNA-Leu
    808. Escherichia coli 2851500 tRNA-Leu
    809. Escherichia coli 2853500 tRNA-Leu
    810. Escherichia coli 2854350 tRNA-Leu
    811. Escherichia coli 2860050 tRNA-Leu
    812. Escherichia coli 2860650 tRNA-Leu
    813. Escherichia coli 2861200 tRNA-Leu
    814. Escherichia coli 2862600 tRNA-Leu
    815. Escherichia coli 2864350 tRNA-Leu
    816. Escherichia coli 2865200 tRNA-Leu
    817. Escherichia coli 2866350 tRNA-Leu
    818. Escherichia coli 2866450 tRNA-Leu
    819. Escherichia coli 2866550 tRNA-Leu
    820. Escherichia coli 2866750 tRNA-Leu
    821. Escherichia coli 2867750 tRNA-Leu
    822. Escherichia coli 2871950 tRNA-Leu
    823. Escherichia coli 2872000 tRNA-Leu
    824. Escherichia coli 2872800 tRNA-Leu
    825. Escherichia coli 2875000 tRNA-Leu
    826. Escherichia coli 2875150 tRNA-Leu
    827. Escherichia coli 2886-75 tRNA-Leu
    828. Escherichia coli 3003 tRNA-Leu
    829. Escherichia coli 3006 tRNA-Leu
    830. Escherichia coli 3-020-07_S1_C1 tRNA-Leu
    831. Escherichia coli 3-020-07_S1_C2 tRNA-Leu
    832. Escherichia coli 3-020-07_S1_C3 tRNA-Leu
    833. Escherichia coli 3-020-07_S3_C1 tRNA-Leu
    834. Escherichia coli 3-020-07_S3_C2 tRNA-Leu
    835. Escherichia coli 3-020-07_S4_C1 tRNA-Leu
    836. Escherichia coli 3-020-07_S4_C2 tRNA-Leu
    837. Escherichia coli 3-020-07_S4_C3 tRNA-Leu
    838. Escherichia coli 3030-1 tRNA-Leu
    839. Escherichia coli 3-073-06_S1_C1 tRNA-Leu
    840. Escherichia coli 3-073-06_S1_C2 tRNA-Leu
    841. Escherichia coli 3-073-06_S3_C1 tRNA-Leu
    842. Escherichia coli 3-073-06_S3_C2 tRNA-Leu
    843. Escherichia coli 3-073-06_S4_C1 tRNA-Leu
    844. Escherichia coli 3-073-06_S4_C2 tRNA-Leu
    845. Escherichia coli 3-073-06_S4_C3 tRNA-Leu
    846. Escherichia coli 3-105-05_S1_C1 tRNA-Leu
    847. Escherichia coli 3-105-05_S1_C2 tRNA-Leu
    848. Escherichia coli 3-105-05_S1_C3 tRNA-Leu
    849. Escherichia coli 3-105-05_S3_C1 tRNA-Leu
    850. Escherichia coli 3-105-05_S3_C2 tRNA-Leu
    851. Escherichia coli 3-105-05_S3_C3 tRNA-Leu
    852. Escherichia coli 3-105-05_S4_C1 tRNA-Leu
    853. Escherichia coli 3-105-05_S4_C2 tRNA-Leu
    854. Escherichia coli 3-105-05_S4_C3 tRNA-Leu
    855. Escherichia coli 3.2303 tRNA-Leu
    856. Escherichia coli 3.2608 tRNA-Leu
    857. Escherichia coli 3-267-03_S1_C1 tRNA-Leu
    858. Escherichia coli 3-267-03_S1_C2 tRNA-Leu
    859. Escherichia coli 3-267-03_S1_C3 tRNA-Leu
    860. Escherichia coli 3-267-03_S3_C1 tRNA-Leu
    861. Escherichia coli 3-267-03_S3_C2 tRNA-Leu
    862. Escherichia coli 3-267-03_S4_C1 tRNA-Leu
    863. Escherichia coli 3-267-03_S4_C2 tRNA-Leu
    864. Escherichia coli 3-373-03_S1_C1 tRNA-Leu
    865. Escherichia coli 3-373-03_S1_C2 tRNA-Leu
    866. Escherichia coli 3-373-03_S1_C3 tRNA-Leu
    867. Escherichia coli 3-373-03_S3_C1 tRNA-Leu
    868. Escherichia coli 3-373-03_S3_C2 tRNA-Leu
    869. Escherichia coli 3-373-03_S3_C3 tRNA-Leu
    870. Escherichia coli 3-373-03_S4_C1 tRNA-Leu
    871. Escherichia coli 3-373-03_S4_C2 tRNA-Leu
    872. Escherichia coli 3-373-03_S4_C3 tRNA-Leu
    873. Escherichia coli 3.3884 tRNA-Leu
    874. Escherichia coli 3431 tRNA-Leu
    875. Escherichia coli 3-475-03_S1_C1 tRNA-Leu
    876. Escherichia coli 3-475-03_S1_C2 tRNA-Leu
    877. Escherichia coli 3-475-03_S3_C1 tRNA-Leu
    878. Escherichia coli 3-475-03_S3_C2 tRNA-Leu
    879. Escherichia coli 3-475-03_S4_C1 tRNA-Leu
    880. Escherichia coli 3-475-03_S4_C2 tRNA-Leu
    881. Escherichia coli 3.4870 tRNA-Leu
    882. Escherichia coli 3.4880 tRNA-Leu
    883. Escherichia coli 4.0522 tRNA-Leu
    884. Escherichia coli 4.0967 tRNA-Leu
    885. Escherichia coli 4_1_47FAA tRNA-Leu
    886. Escherichia coli 4-203-08_S1_C1 tRNA-Leu
    887. Escherichia coli 4-203-08_S1_C2 tRNA-Leu
    888. Escherichia coli 4-203-08_S1_C3 tRNA-Leu
    889. Escherichia coli 4-203-08_S3_C1 tRNA-Leu
    890. Escherichia coli 4-203-08_S3_C2 tRNA-Leu
    891. Escherichia coli 4-203-08_S3_C3 tRNA-Leu
    892. Escherichia coli 4-203-08_S4_C2 tRNA-Leu
    893. Escherichia coli 4-203-08_S4_C3 tRNA-Leu
    894. Escherichia coli 5.0588 tRNA-Leu
    895. Escherichia coli 5.0959 tRNA-Leu
    896. Escherichia coli 5-172-05_S1_C3 tRNA-Leu
    897. Escherichia coli 5-172-05_S3_C1 tRNA-Leu
    898. Escherichia coli 5-172-05_S3_C3 tRNA-Leu
    899. Escherichia coli 5.2239 tRNA-Leu
    900. Escherichia coli 5-366-08_S1_C1 tRNA-Leu
    901. Escherichia coli 5-366-08_S1_C3 tRNA-Leu
    902. Escherichia coli 5-366-08_S3_C1 tRNA-Leu
    903. Escherichia coli 5-366-08_S3_C2 tRNA-Leu
    904. Escherichia coli 5-366-08_S3_C3 tRNA-Leu
    905. Escherichia coli 5-366-08_S4_C1 tRNA-Leu
    906. Escherichia coli 5-366-08_S4_C2 tRNA-Leu
    907. Escherichia coli 541-15 tRNA-Leu
    908. Escherichia coli 541-1 tRNA-Leu
    909. Escherichia coli 5412 tRNA-Leu
    910. Escherichia coli 55989 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    911. Escherichia coli 576-1 tRNA-Leu
    912. Escherichia coli 5905 tRNA-Leu
    913. Escherichia coli 6.0172 tRNA-Leu
    914. Escherichia coli 6-175-07_S1_C1 tRNA-Leu
    915. Escherichia coli 6-175-07_S1_C2 tRNA-Leu
    916. Escherichia coli 6-175-07_S1_C3 tRNA-Leu
    917. Escherichia coli 6-175-07_S3_C1 tRNA-Leu
    918. Escherichia coli 6-175-07_S3_C2 tRNA-Leu
    919. Escherichia coli 6-175-07_S3_C3 tRNA-Leu
    920. Escherichia coli 6-175-07_S4_C1 tRNA-Leu
    921. Escherichia coli 6-175-07_S4_C2 tRNA-Leu
    922. Escherichia coli 6-175-07_S4_C3 tRNA-Leu
    923. Escherichia coli 6-319-05_S1_C1 tRNA-Leu
    924. Escherichia coli 6-319-05_S1_C2 tRNA-Leu
    925. Escherichia coli 6-319-05_S1_C3 tRNA-Leu
    926. Escherichia coli 6-319-05_S3_C1 tRNA-Leu
    927. Escherichia coli 6-319-05_S3_C2 tRNA-Leu
    928. Escherichia coli 6-319-05_S3_C3 tRNA-Leu
    929. Escherichia coli 6-319-05_S4_C2 tRNA-Leu
    930. Escherichia coli 6-319-05_S4_C3 tRNA-Leu
    931. Escherichia coli 6-537-08_S1_C1 tRNA-Leu
    932. Escherichia coli 6-537-08_S1_C2 tRNA-Leu
    933. Escherichia coli 6-537-08_S1_C3 tRNA-Leu
    934. Escherichia coli 6-537-08_S3_C1 tRNA-Leu
    935. Escherichia coli 6-537-08_S3_C2 tRNA-Leu
    936. Escherichia coli 6-537-08_S3_C3 tRNA-Leu
    937. Escherichia coli 6-537-08_S4_C1 tRNA-Leu
    938. Escherichia coli 6-537-08_S4_C2 tRNA-Leu
    939. Escherichia coli 7.1982 tRNA-Leu
    940. Escherichia coli 7-233-03_S1_C2 tRNA-Leu
    941. Escherichia coli 7-233-03_S1_C3 tRNA-Leu
    942. Escherichia coli 7-233-03_S3_C1 tRNA-Leu
    943. Escherichia coli 7-233-03_S3_C2 tRNA-Leu
    944. Escherichia coli 7-233-03_S3_C3 tRNA-Leu
    945. Escherichia coli 7-233-03_S4_C1 tRNA-Leu
    946. Escherichia coli 7-233-03_S4_C2 tRNA-Leu
    947. Escherichia coli 7-233-03_S4_C3 tRNA-Leu
    948. Escherichia coli 75 tRNA-Leu
    949. Escherichia coli 8.0416 tRNA-Leu
    950. Escherichia coli 8.0566 tRNA-Leu
    951. Escherichia coli 8.0569 tRNA-Leu
    952. Escherichia coli 8.0586 tRNA-Leu
    953. Escherichia coli 8.2524 tRNA-Leu
    954. Escherichia coli 83972 tRNA-Leu
    955. Escherichia coli 8-415-05_S1_C1 tRNA-Leu
    956. Escherichia coli 8-415-05_S1_C2 tRNA-Leu
    957. Escherichia coli 8-415-05_S3_C1 tRNA-Leu
    958. Escherichia coli 8-415-05_S3_C2 tRNA-Leu
    959. Escherichia coli 8-415-05_S3_C3 tRNA-Leu
    960. Escherichia coli 8-415-05_S4_C1 tRNA-Leu
    961. Escherichia coli 8-415-05_S4_C2 tRNA-Leu
    962. Escherichia coli 8-415-05_S4_C3 tRNA-Leu
    963. Escherichia coli 88.0221 tRNA-Leu
    964. Escherichia coli 88.1042 tRNA-Leu
    965. Escherichia coli 88.1467 tRNA-Leu
    966. Escherichia coli 89.0511 tRNA-Leu
    967. Escherichia coli 90.0039 tRNA-Leu
    968. Escherichia coli 90.0091 tRNA-Leu
    969. Escherichia coli 900105 (10e) (10e) tRNA-Leu
    970. Escherichia coli 9.0111 tRNA-Leu
    971. Escherichia coli 90.2281 tRNA-Leu
    972. Escherichia coli 907357 tRNA-Leu
    973. Escherichia coli 907391 tRNA-Leu
    974. Escherichia coli 907446 tRNA-Leu
    975. Escherichia coli 907672 tRNA-Leu
    976. Escherichia coli 907700 tRNA-Leu
    977. Escherichia coli 907701 tRNA-Leu
    978. Escherichia coli 907710 tRNA-Leu
    979. Escherichia coli 907713 tRNA-Leu
    980. Escherichia coli 907715 tRNA-Leu
    981. Escherichia coli 907779 tRNA-Leu
    982. Escherichia coli 907889 tRNA-Leu
    983. Escherichia coli 907892 tRNA-Leu
    984. Escherichia coli 908519 tRNA-Leu
    985. Escherichia coli 908521 tRNA-Leu
    986. Escherichia coli 908522 tRNA-Leu
    987. Escherichia coli 908524 tRNA-Leu
    988. Escherichia coli 908525 tRNA-Leu
    989. Escherichia coli 908541 tRNA-Leu
    990. Escherichia coli 908555 tRNA-Leu
    991. Escherichia coli 908573 tRNA-Leu
    992. Escherichia coli 908585 tRNA-Leu
    993. Escherichia coli 908616 tRNA-Leu
    994. Escherichia coli 908624 tRNA-Leu
    995. Escherichia coli 908632 tRNA-Leu
    996. Escherichia coli 908658 tRNA-Leu
    997. Escherichia coli 908675 tRNA-Leu
    998. Escherichia coli 908691 tRNA-Leu
    999. Escherichia coli 909945-2 tRNA-Leu
    1000. Escherichia coli 910096-2 tRNA-Leu
    1001. Escherichia coli 9.1649 tRNA-Leu
    1002. Escherichia coli 93-001 tRNA-Leu
    1003. Escherichia coli 93.0055 tRNA-Leu
    1004. Escherichia coli 93.0056 tRNA-Leu
    1005. Escherichia coli 93.0624 tRNA-Leu
    1006. Escherichia coli 94.0618 tRNA-Leu
    1007. Escherichia coli 95.0083 tRNA-Leu
    1008. Escherichia coli 95.0183 tRNA-Leu
    1009. Escherichia coli 95.0943 tRNA-Leu
    1010. Escherichia coli 95.1288 tRNA-Leu
    1011. Escherichia coli 95JB1 tRNA-Leu
    1012. Escherichia coli 95NR1 tRNA-Leu
    1013. Escherichia coli 96.0107 tRNA-Leu
    1014. Escherichia coli 96.0109 tRNA-Leu
    1015. Escherichia coli 96.0427 tRNA-Leu
    1016. Escherichia coli 96.0428 tRNA-Leu
    1017. Escherichia coli 96.0497 tRNA-Leu
    1018. Escherichia coli 96.0932 tRNA-Leu
    1019. Escherichia coli 96.0939 tRNA-Leu
    1020. Escherichia coli 96.154 tRNA-Leu
    1021. Escherichia coli 97.0003 tRNA-Leu
    1022. Escherichia coli 97.0007 tRNA-Leu
    1023. Escherichia coli 97.0010 tRNA-Leu
    1024. Escherichia coli 97.0246 tRNA-Leu
    1025. Escherichia coli 97.0259 tRNA-Leu
    1026. Escherichia coli 97.0264 tRNA-Leu
    1027. Escherichia coli 97.1742 tRNA-Leu
    1028. Escherichia coli 99.0670 tRNA-Leu
    1029. Escherichia coli 99.0672 tRNA-Leu
    1030. Escherichia coli 99.0713 tRNA-Leu
    1031. Escherichia coli 99.0741 tRNA-Leu
    1032. Escherichia coli 99.0814 tRNA-Leu
    1033. Escherichia coli 99.0815 tRNA-Leu
    1034. Escherichia coli 99.0816 tRNA-Leu
    1035. Escherichia coli 99.0839 tRNA-Leu
    1036. Escherichia coli 99.0848 tRNA-Leu
    1037. Escherichia coli 99.1753 tRNA-Leu
    1038. Escherichia coli 99.1762 tRNA-Leu
    1039. Escherichia coli 99.1775 tRNA-Leu
    1040. Escherichia coli 99.1781 tRNA-Leu
    1041. Escherichia coli 99.1793 tRNA-Leu
    1042. Escherichia coli 99.1805 tRNA-Leu
    1043. Escherichia coli A25922R tRNA-Leu
    1044. Escherichia coli A35218R tRNA-Leu
    1045. Escherichia coli AA86 tRNA-Leu
    1046. Escherichia coli ABU 83972 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1047. Escherichia coli ACN001 tRNA-Leu
    1048. Escherichia coli AD30 tRNA-Leu
    1049. Escherichia coli AI27 tRNA-Leu
    1050. Escherichia coli APEC IMT5155 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1051. Escherichia coli APEC O18 tRNA-Leu
    1052. Escherichia coli APEC O1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1053. Escherichia coli APEC O2-211 tRNA-Leu
    1054. Escherichia coli APEC O2 tRNA-Leu
    1055. Escherichia coli APEC O78 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1056. Escherichia coli ARS4.2123 tRNA-Leu
    1057. Escherichia coli ATCC 25922 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1058. Escherichia coli ATCC 35150 tRNA-Leu
    1059. Escherichia coli ATCC 700728 tRNA-Leu
    1060. Escherichia coli ATCC 8739 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1061. Escherichia coli ATCC BAA-2192 tRNA-Leu
    1062. Escherichia coli ATCC BAA-2193 tRNA-Leu
    1063. Escherichia coli ATCC BAA-2196 tRNA-Leu
    1064. Escherichia coli ATCC BAA-2209 tRNA-Leu
    1065. Escherichia coli ATCC BAA-2215 tRNA-Leu
    1066. Escherichia coli ATCC BAA-2219 tRNA-Leu
    1067. Escherichia coli B088 tRNA-Leu
    1068. Escherichia coli B102 tRNA-Leu
    1069. Escherichia coli B103 tRNA-Leu
    1070. Escherichia coli B104 tRNA-Leu
    1071. Escherichia coli B105 tRNA-Leu
    1072. Escherichia coli B106 tRNA-Leu
    1073. Escherichia coli B107 tRNA-Leu
    1074. Escherichia coli B108 tRNA-Leu
    1075. Escherichia coli B109 tRNA-Leu
    1076. Escherichia coli B112 tRNA-Leu
    1077. Escherichia coli B113 tRNA-Leu
    1078. Escherichia coli B114 tRNA-Leu
    1079. Escherichia coli B15 tRNA-Leu
    1080. Escherichia coli B175 tRNA-Leu
    1081. Escherichia coli B17 tRNA-Leu
    1082. Escherichia coli B185 tRNA-Leu
    1083. Escherichia coli B26-1 tRNA-Leu
    1084. Escherichia coli B26-2 tRNA-Leu
    1085. Escherichia coli B28-1 tRNA-Leu
    1086. Escherichia coli B28-2 tRNA-Leu
    1087. Escherichia coli B29-1 tRNA-Leu
    1088. Escherichia coli B29-2 tRNA-Leu
    1089. Escherichia coli B354 tRNA-Leu
    1090. Escherichia coli B36-1 tRNA-Leu
    1091. Escherichia coli B36-2 tRNA-Leu
    1092. Escherichia coli B367 tRNA-Leu
    1093. Escherichia coli B40-1 tRNA-Leu
    1094. Escherichia coli B40-2 tRNA-Leu
    1095. Escherichia coli B41 tRNA-Leu
    1096. Escherichia coli B49-2 tRNA-Leu
    1097. Escherichia coli B5-2 tRNA-Leu
    1098. Escherichia coli B574 tRNA-Leu
    1099. Escherichia coli B671 tRNA-Leu
    1100. Escherichia coli B7-1 tRNA-Leu
    1101. Escherichia coli B7-2 tRNA-Leu
    1102. Escherichia coli B7A tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1103. Escherichia coli B83 tRNA-Leu
    1104. Escherichia coli B84 tRNA-Leu
    1105. Escherichia coli B85 tRNA-Leu
    1106. Escherichia coli B86 tRNA-Leu
    1107. Escherichia coli B89 tRNA-Leu
    1108. Escherichia coli B90 tRNA-Leu
    1109. Escherichia coli B921 tRNA-Leu
    1110. Escherichia coli B93 tRNA-Leu
    1111. Escherichia coli B94 tRNA-Leu
    1112. Escherichia coli B95 tRNA-Leu
    1113. Escherichia coli BCE001_MS16 tRNA-Leu
    1114. Escherichia coli BCE002_MS12 tRNA-Leu
    1115. Escherichia coli BCE006_MS-23 tRNA-Leu
    1116. Escherichia coli BCE007_MS-11 tRNA-Leu
    1117. Escherichia coli BCE008_MS-01 tRNA-Leu
    1118. Escherichia coli BCE008_MS-13 tRNA-Leu
    1119. Escherichia coli BCE011_MS-01 tRNA-Leu
    1120. Escherichia coli BCE019_MS-13 tRNA-Leu
    1121. Escherichia coli BCE030_MS-09 tRNA-Leu
    1122. Escherichia coli BCE032_MS-12 tRNA-Leu
    1123. Escherichia coli BCE034_MS-14 tRNA-Leu
    1124. Escherichia coli Bd5610_99 tRNA-Leu
    1125. Escherichia coli BIDMC 15 tRNA-Leu
    1126. Escherichia coli BIDMC 17A tRNA-Leu
    1127. Escherichia coli BIDMC 17B tRNA-Leu
    1128. Escherichia coli BIDMC 19A tRNA-Leu
    1129. Escherichia coli BIDMC 19B tRNA-Leu
    1130. Escherichia coli BIDMC 19C tRNA-Leu
    1131. Escherichia coli BIDMC 20A tRNA-Leu
    1132. Escherichia coli BIDMC 20B tRNA-Leu
    1133. Escherichia coli BIDMC 2B tRNA-Leu
    1134. Escherichia coli BIDMC 37 tRNA-Leu
    1135. Escherichia coli BIDMC 38 tRNA-Leu
    1136. Escherichia coli BIDMC 39 tRNA-Leu
    1137. Escherichia coli BIDMC 3 tRNA-Leu
    1138. Escherichia coli BIDMC 43a tRNA-Leu
    1139. Escherichia coli BIDMC 43b tRNA-Leu
    1140. Escherichia coli BIDMC 49a tRNA-Leu
    1141. Escherichia coli BIDMC 49b tRNA-Leu
    1142. Escherichia coli BIDMC 58 tRNA-Leu
    1143. Escherichia coli BIDMC 59 tRNA-Leu
    1144. Escherichia coli BIDMC 62 tRNA-Leu
    1145. Escherichia coli BIDMC 63 tRNA-Leu
    1146. Escherichia coli BIDMC 64 tRNA-Leu
    1147. Escherichia coli BIDMC 65 tRNA-Leu
    1148. Escherichia coli BIDMC 6 tRNA-Leu
    1149. Escherichia coli BIDMC 70 tRNA-Leu
    1150. Escherichia coli BIDMC 71 tRNA-Leu
    1151. Escherichia coli BIDMC 72 tRNA-Leu
    1152. Escherichia coli BIDMC 73 tRNA-Leu
    1153. Escherichia coli BIDMC 74 tRNA-Leu
    1154. Escherichia coli BIDMC 75 tRNA-Leu
    1155. Escherichia coli BIDMC 76 tRNA-Leu
    1156. Escherichia coli BIDMC 77 tRNA-Leu
    1157. Escherichia coli BIDMC 78 tRNA-Leu
    1158. Escherichia coli BIDMC 79 tRNA-Leu
    1159. Escherichia coli BIDMC 82 tRNA-Leu
    1160. Escherichia coli BIDMC 83 tRNA-Leu
    1161. Escherichia coli BIDMC 9 tRNA-Leu
    1162. Escherichia coli BL21(DE3) tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1163. Escherichia coli 'BL21-Gold(DE3)pLysS AG' tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1164. Escherichia coli BL21 tRNA-Leu
    1165. Escherichia coli B str. REL606 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1166. Escherichia coli B tRNA-Leu
    1167. Escherichia coli BW25113 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1168. Escherichia coli BW2952 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1169. Escherichia coli BWH 24 tRNA-Leu
    1170. Escherichia coli BWH 32 tRNA-Leu
    1171. Escherichia coli BWH 34 tRNA-Leu
    1172. Escherichia coli BWH 40 tRNA-Leu
    1173. Escherichia coli C-34666 tRNA-Leu
    1174. Escherichia coli C691-71 (14b) tRNA-Leu
    1175. Escherichia coli CAG:4 transfer RNA-Leu(TAG)
    1176. Escherichia coli CB7326 tRNA-Leu
    1177. Escherichia coli CFT073 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1178. Escherichia coli CHS 68 tRNA-Leu
    1179. Escherichia coli CHS 69 tRNA-Leu
    1180. Escherichia coli CHS 77 tRNA-Leu
    1181. Escherichia coli CUMT8 tRNA-Leu
    1182. Escherichia coli D6-113.11 transfer RNA-Leu
    1183. Escherichia coli D9 tRNA-Leu
    1184. Escherichia coli DEC10A tRNA-Leu
    1185. Escherichia coli DEC10B tRNA-Leu
    1186. Escherichia coli DEC10C tRNA-Leu
    1187. Escherichia coli DEC10D tRNA-Leu
    1188. Escherichia coli DEC10E tRNA-Leu
    1189. Escherichia coli DEC10F tRNA-Leu
    1190. Escherichia coli DEC11A tRNA-Leu
    1191. Escherichia coli DEC11B tRNA-Leu
    1192. Escherichia coli DEC11C tRNA-Leu
    1193. Escherichia coli DEC11D tRNA-Leu
    1194. Escherichia coli DEC11E tRNA-Leu
    1195. Escherichia coli DEC12A tRNA-Leu
    1196. Escherichia coli DEC12B tRNA-Leu
    1197. Escherichia coli DEC12C tRNA-Leu
    1198. Escherichia coli DEC12D tRNA-Leu
    1199. Escherichia coli DEC12E tRNA-Leu
    1200. Escherichia coli DEC13A tRNA-Leu
    1201. Escherichia coli DEC13B tRNA-Leu
    1202. Escherichia coli DEC13C tRNA-Leu
    1203. Escherichia coli DEC13D tRNA-Leu
    1204. Escherichia coli DEC13E tRNA-Leu
    1205. Escherichia coli DEC14A tRNA-Leu
    1206. Escherichia coli DEC14B tRNA-Leu
    1207. Escherichia coli DEC14C tRNA-Leu
    1208. Escherichia coli DEC14D tRNA-Leu
    1209. Escherichia coli DEC15A tRNA-Leu
    1210. Escherichia coli DEC15B tRNA-Leu
    1211. Escherichia coli DEC15C tRNA-Leu
    1212. Escherichia coli DEC15D tRNA-Leu
    1213. Escherichia coli DEC15E tRNA-Leu
    1214. Escherichia coli DEC1A tRNA-Leu
    1215. Escherichia coli DEC1B tRNA-Leu
    1216. Escherichia coli DEC1C tRNA-Leu
    1217. Escherichia coli DEC1D tRNA-Leu
    1218. Escherichia coli DEC1E tRNA-Leu
    1219. Escherichia coli DEC2A tRNA-Leu
    1220. Escherichia coli DEC2B tRNA-Leu
    1221. Escherichia coli DEC2C tRNA-Leu
    1222. Escherichia coli DEC2D tRNA-Leu
    1223. Escherichia coli DEC2E tRNA-Leu
    1224. Escherichia coli DEC3A tRNA-Leu
    1225. Escherichia coli DEC3B tRNA-Leu
    1226. Escherichia coli DEC3C tRNA-Leu
    1227. Escherichia coli DEC3D tRNA-Leu
    1228. Escherichia coli DEC3E tRNA-Leu
    1229. Escherichia coli DEC3F tRNA-Leu
    1230. Escherichia coli DEC4A tRNA-Leu
    1231. Escherichia coli DEC4B tRNA-Leu
    1232. Escherichia coli DEC4C tRNA-Leu
    1233. Escherichia coli DEC4D tRNA-Leu
    1234. Escherichia coli DEC4E tRNA-Leu
    1235. Escherichia coli DEC4F tRNA-Leu
    1236. Escherichia coli DEC5A tRNA-Leu
    1237. Escherichia coli DEC5B tRNA-Leu
    1238. Escherichia coli DEC5C tRNA-Leu
    1239. Escherichia coli DEC5D tRNA-Leu
    1240. Escherichia coli DEC5E tRNA-Leu
    1241. Escherichia coli DEC6A tRNA-Leu
    1242. Escherichia coli DEC6B tRNA-Leu
    1243. Escherichia coli DEC6C tRNA-Leu
    1244. Escherichia coli DEC6D tRNA-Leu
    1245. Escherichia coli DEC6E tRNA-Leu
    1246. Escherichia coli DEC7A tRNA-Leu
    1247. Escherichia coli DEC7B tRNA-Leu
    1248. Escherichia coli DEC7C tRNA-Leu
    1249. Escherichia coli DEC7D tRNA-Leu
    1250. Escherichia coli DEC7E tRNA-Leu
    1251. Escherichia coli DEC8A tRNA-Leu
    1252. Escherichia coli DEC8B tRNA-Leu
    1253. Escherichia coli DEC8C tRNA-Leu
    1254. Escherichia coli DEC8D tRNA-Leu
    1255. Escherichia coli DEC8E tRNA-Leu
    1256. Escherichia coli DEC9A tRNA-Leu
    1257. Escherichia coli DEC9B tRNA-Leu
    1258. Escherichia coli DEC9C tRNA-Leu
    1259. Escherichia coli DEC9D tRNA-Leu
    1260. Escherichia coli DEC9E tRNA-Leu
    1261. Escherichia coli DH1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1262. Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 tRNA-Leu
    1263. Escherichia coli E1002 tRNA-Leu
    1264. Escherichia coli E101 tRNA-Leu
    1265. Escherichia coli E1114 tRNA-Leu
    1266. Escherichia coli E1118 tRNA-Leu
    1267. Escherichia coli E1140 tRNA-Leu
    1268. Escherichia coli E1167 tRNA-Leu
    1269. Escherichia coli E128010 tRNA-Leu
    1270. Escherichia coli E1520 tRNA-Leu
    1271. Escherichia coli E1728 tRNA-Leu
    1272. Escherichia coli E267 tRNA-Leu
    1273. Escherichia coli E482 tRNA-Leu
    1274. Escherichia coli E560 tRNA-Leu
    1275. Escherichia coli E704 tRNA-Leu
    1276. Escherichia coli EC096/10 tRNA-Leu
    1277. Escherichia coli EC1734 tRNA-Leu
    1278. Escherichia coli EC1735 tRNA-Leu
    1279. Escherichia coli EC1736 tRNA-Leu
    1280. Escherichia coli EC1737 tRNA-Leu
    1281. Escherichia coli EC1738 tRNA-Leu
    1282. Escherichia coli EC1845 tRNA-Leu
    1283. Escherichia coli EC1846 tRNA-Leu
    1284. Escherichia coli EC1847 tRNA-Leu
    1285. Escherichia coli EC1848 tRNA-Leu
    1286. Escherichia coli EC1849 tRNA-Leu
    1287. Escherichia coli EC1850 tRNA-Leu
    1288. Escherichia coli EC1856 tRNA-Leu
    1289. Escherichia coli EC1862 tRNA-Leu
    1290. Escherichia coli EC1863 tRNA-Leu
    1291. Escherichia coli EC1864 tRNA-Leu
    1292. Escherichia coli EC1865 tRNA-Leu
    1293. Escherichia coli EC1866 tRNA-Leu
    1294. Escherichia coli EC1868 tRNA-Leu
    1295. Escherichia coli EC1869 tRNA-Leu
    1296. Escherichia coli EC1870 tRNA-Leu
    1297. Escherichia coli EC4013 tRNA-Leu
    1298. Escherichia coli EC4196 tRNA-Leu
    1299. Escherichia coli EC4203 tRNA-Leu
    1300. Escherichia coli EC4402 tRNA-Leu
    1301. Escherichia coli EC4421 tRNA-Leu
    1302. Escherichia coli EC4422 tRNA-Leu
    1303. Escherichia coli EC4436 tRNA-Leu
    1304. Escherichia coli EC4437 tRNA-Leu
    1305. Escherichia coli EC4439 tRNA-Leu
    1306. Escherichia coli EC4448 tRNA-Leu
    1307. Escherichia coli EC96038 tRNA-Leu
    1308. Escherichia coli ECC-1470 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1309. Escherichia coli ECC-Z tRNA-Leu
    1310. Escherichia coli ED1a tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1311. Escherichia coli Envira 10/1 tRNA-Leu
    1312. Escherichia coli Envira 8/11 tRNA-Leu
    1313. Escherichia coli EPECa12 tRNA-Leu
    1314. Escherichia coli EPECa14 tRNA-Leu
    1315. Escherichia coli EPEC C342-62 tRNA-Leu
    1316. Escherichia coli ER2796 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1317. Escherichia coli ETEC H10407 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1318. Escherichia coli FAP1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1319. Escherichia coli FDA504 tRNA-Leu
    1320. Escherichia coli FDA505 tRNA-Leu
    1321. Escherichia coli FDA506 tRNA-Leu
    1322. Escherichia coli FDA507 tRNA-Leu
    1323. Escherichia coli FDA517 tRNA-Leu
    1324. Escherichia coli FRIK1985 tRNA-Leu
    1325. Escherichia coli FRIK1990 tRNA-Leu
    1326. Escherichia coli FRIK1996 tRNA-Leu
    1327. Escherichia coli FRIK1997 tRNA-Leu
    1328. Escherichia coli FRIK1999 tRNA-Leu
    1329. Escherichia coli FRIK2001 tRNA-Leu
    1330. Escherichia coli FRIK523 tRNA-Leu
    1331. Escherichia coli FRIK920 tRNA-Leu
    1332. Escherichia coli FVEC1302 tRNA-Leu
    1333. Escherichia coli FVEC1412 tRNA-Leu
    1334. Escherichia coli FVEC1465 tRNA-Leu
    1335. Escherichia coli G3/10 tRNA-Leu
    1336. Escherichia coli G58-1 tRNA-Leu
    1337. Escherichia coli H001 tRNA-Leu
    1338. Escherichia coli H120 tRNA-Leu
    1339. Escherichia coli H19 tRNA-Leu
    1340. Escherichia coli H20 tRNA-Leu
    1341. Escherichia coli H252 tRNA-Leu
    1342. Escherichia coli H263 tRNA-Leu
    1343. Escherichia coli H296 tRNA-Leu
    1344. Escherichia coli H299 tRNA-Leu
    1345. Escherichia coli H305 tRNA-Leu
    1346. Escherichia coli H378 tRNA-Leu
    1347. Escherichia coli H383 tRNA-Leu
    1348. Escherichia coli H386 tRNA-Leu
    1349. Escherichia coli H397 tRNA-Leu
    1350. Escherichia coli H413 tRNA-Leu
    1351. Escherichia coli H420 tRNA-Leu
    1352. Escherichia coli H454 tRNA-Leu
    1353. Escherichia coli H461 tRNA-Leu
    1354. Escherichia coli H489 tRNA-Leu
    1355. Escherichia coli H494 tRNA-Leu
    1356. Escherichia coli H588 tRNA-Leu
    1357. Escherichia coli H591 tRNA-Leu
    1358. Escherichia coli H605 tRNA-Leu
    1359. Escherichia coli H617 tRNA-Leu
    1360. Escherichia coli H730 tRNA-Leu
    1361. Escherichia coli H736 tRNA-Leu
    1362. Escherichia coli H8 tRNA-Leu
    1363. Escherichia coli HM605 tRNA-Leu
    1364. Escherichia coli HS tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1365. Escherichia coli HT115 tRNA-Leu
    1366. Escherichia coli HVH 100 (4-2850729) tRNA-Leu
    1367. Escherichia coli HVH 101 (4-6859844) tRNA-Leu
    1368. Escherichia coli HVH 102 (4-6906788) tRNA-Leu
    1369. Escherichia coli HVH 103 (4-5904188) tRNA-Leu
    1370. Escherichia coli HVH 104 (4-6977960) (4-6977960) tRNA-Leu
    1371. Escherichia coli HVH 10 (4-6832164) tRNA-Leu
    1372. Escherichia coli HVH 106 (4-6881831) tRNA-Leu
    1373. Escherichia coli HVH 107 (4-5860571) tRNA-Leu
    1374. Escherichia coli HVH 108 (4-6924867) (4-6924867) tRNA-Leu
    1375. Escherichia coli HVH 109 (4-6977162) tRNA-Leu
    1376. Escherichia coli HVH 110 (4-6978754) tRNA-Leu
    1377. Escherichia coli HVH 111 (4-7039018) (4-7039018) tRNA-Leu
    1378. Escherichia coli HVH 112 (4-5987253) tRNA-Leu
    1379. Escherichia coli HVH 113 (4-7535473) (4-7535473) tRNA-Leu
    1380. Escherichia coli HVH 114 (4-7037740) tRNA-Leu
    1381. Escherichia coli HVH 115 (4-4465989) tRNA-Leu
    1382. Escherichia coli HVH 115 (4-4465997) tRNA-Leu
    1383. Escherichia coli HVH 116 (4-6879942) (4-6879942) tRNA-Leu
    1384. Escherichia coli HVH 117 (4-6857191) tRNA-Leu
    1385. Escherichia coli HVH 118 (4-7345399) tRNA-Leu
    1386. Escherichia coli HVH 119 (4-6879578) tRNA-Leu
    1387. Escherichia coli HVH 120 (4-6978681) tRNA-Leu
    1388. Escherichia coli HVH 121 (4-6877826) (4-6877826) tRNA-Leu
    1389. Escherichia coli HVH 122 (4-6851606) tRNA-Leu
    1390. Escherichia coli HVH 12 (4-7653042) tRNA-Leu
    1391. Escherichia coli HVH 125 (4-2634716) tRNA-Leu
    1392. Escherichia coli HVH 126 (4-6034225) tRNA-Leu
    1393. Escherichia coli HVH 127 (4-7303629) tRNA-Leu
    1394. Escherichia coli HVH 128 (4-7030436) tRNA-Leu
    1395. Escherichia coli HVH 130 (4-7036876) (4-7036876) tRNA-Leu
    1396. Escherichia coli HVH 132 (4-6876862) tRNA-Leu
    1397. Escherichia coli HVH 133 (4-4466519) tRNA-Leu
    1398. Escherichia coli HVH 134 (4-6073441) tRNA-Leu
    1399. Escherichia coli HVH 13 (4-7634056) tRNA-Leu
    1400. Escherichia coli HVH 135 (4-4449320) tRNA-Leu
    1401. Escherichia coli HVH 136 (4-5970458) tRNA-Leu
    1402. Escherichia coli HVH 137 (4-2124971) tRNA-Leu
    1403. Escherichia coli HVH 138 (4-6066704) tRNA-Leu
    1404. Escherichia coli HVH 139 (4-3192644) tRNA-Leu
    1405. Escherichia coli HVH 140 (4-5894387) tRNA-Leu
    1406. Escherichia coli HVH 141 (4-5995973) tRNA-Leu
    1407. Escherichia coli HVH 142 (4-5627451) tRNA-Leu
    1408. Escherichia coli HVH 143 (4-5674999) tRNA-Leu
    1409. Escherichia coli HVH 145 (4-5672112) tRNA-Leu
    1410. Escherichia coli HVH 146 (4-3189767) tRNA-Leu
    1411. Escherichia coli HVH 1 (4-6876161) tRNA-Leu
    1412. Escherichia coli HVH 148 (4-3192490) tRNA-Leu
    1413. Escherichia coli HVH 149 (4-4451880) tRNA-Leu
    1414. Escherichia coli HVH 150 (4-3258106) tRNA-Leu
    1415. Escherichia coli HVH 151 (4-5755573) tRNA-Leu
    1416. Escherichia coli HVH 152 (4-3447545) tRNA-Leu
    1417. Escherichia coli HVH 153 (3-9344314) tRNA-Leu
    1418. Escherichia coli HVH 154 (4-5636698) tRNA-Leu
    1419. Escherichia coli HVH 155 (4-4509048) (4-4509048) tRNA-Leu
    1420. Escherichia coli HVH 156 (4-3206505) (4-3206505) tRNA-Leu
    1421. Escherichia coli HVH 157 (4-3406229) tRNA-Leu
    1422. Escherichia coli HVH 158 (4-3224287) (4-3224287) tRNA-Leu
    1423. Escherichia coli HVH 159 (4-5818141) tRNA-Leu
    1424. Escherichia coli HVH 160 (4-5695937) tRNA-Leu
    1425. Escherichia coli HVH 161 (4-3119890) tRNA-Leu
    1426. Escherichia coli HVH 162 (4-5627982) tRNA-Leu
    1427. Escherichia coli HVH 163 (4-4697553) tRNA-Leu
    1428. Escherichia coli HVH 164 (4-5953081) tRNA-Leu
    1429. Escherichia coli HVH 16 (4-7649002) tRNA-Leu
    1430. Escherichia coli HVH 167 (4-6073565) tRNA-Leu
    1431. Escherichia coli HVH 169 (4-1075578) tRNA-Leu
    1432. Escherichia coli HVH 170 (4-3026949) tRNA-Leu
    1433. Escherichia coli HVH 171 (4-3191958) tRNA-Leu
    1434. Escherichia coli HVH 172 (4-3248542) tRNA-Leu
    1435. Escherichia coli HVH 173 (3-9175482) tRNA-Leu
    1436. Escherichia coli HVH 17 (4-7473087) tRNA-Leu
    1437. Escherichia coli HVH 175 (4-3405184) (4-3405184) tRNA-Leu
    1438. Escherichia coli HVH 176 (4-3428664) (4-3428664) tRNA-Leu
    1439. Escherichia coli HVH 177 (4-2876612) tRNA-Leu
    1440. Escherichia coli HVH 178 (4-3189163) tRNA-Leu
    1441. Escherichia coli HVH 180 (4-3051617) tRNA-Leu
    1442. Escherichia coli HVH 182 (4-0985554) tRNA-Leu
    1443. Escherichia coli HVH 183 (4-3205932) (4-3205932) tRNA-Leu
    1444. Escherichia coli HVH 184 (4-3343286) tRNA-Leu
    1445. Escherichia coli HVH 18 (4-8589585) tRNA-Leu
    1446. Escherichia coli HVH 186 (4-3405044) tRNA-Leu
    1447. Escherichia coli HVH 187 (4-4471660) tRNA-Leu
    1448. Escherichia coli HVH 188 (4-2356988) tRNA-Leu
    1449. Escherichia coli HVH 189 (4-3220125) tRNA-Leu
    1450. Escherichia coli HVH 190 (4-3255514) tRNA-Leu
    1451. Escherichia coli HVH 191 (3-9341900) tRNA-Leu
    1452. Escherichia coli HVH 192 (4-3054470) tRNA-Leu
    1453. Escherichia coli HVH 193 (4-3331423) (4-3331423) tRNA-Leu
    1454. Escherichia coli HVH 194 (4-2356805) tRNA-Leu
    1455. Escherichia coli HVH 19 (4-7154984) tRNA-Leu
    1456. Escherichia coli HVH 195 (3-7155360) tRNA-Leu
    1457. Escherichia coli HVH 196 (4-4530470) tRNA-Leu
    1458. Escherichia coli HVH 197 (4-4466217) tRNA-Leu
    1459. Escherichia coli HVH 199 (4-5670322) tRNA-Leu
    1460. Escherichia coli HVH 200 (4-4449924) tRNA-Leu
    1461. Escherichia coli HVH 201 (4-4459431) tRNA-Leu
    1462. Escherichia coli HVH 202 (4-3163997) tRNA-Leu
    1463. Escherichia coli HVH 203 (4-3126218) tRNA-Leu
    1464. Escherichia coli HVH 204 (4-3112802) (4-3112802) tRNA-Leu
    1465. Escherichia coli HVH 20 (4-5865042) tRNA-Leu
    1466. Escherichia coli HVH 205 (4-3094677) tRNA-Leu
    1467. Escherichia coli HVH 206 (4-3128229) tRNA-Leu
    1468. Escherichia coli HVH 207 (4-3113221) tRNA-Leu
    1469. Escherichia coli HVH 208 (4-3112292) tRNA-Leu
    1470. Escherichia coli HVH 209 (4-3062651) tRNA-Leu
    1471. Escherichia coli HVH 210 (4-3042480) tRNA-Leu
    1472. Escherichia coli HVH 211 (4-3041891) tRNA-Leu
    1473. Escherichia coli HVH 212 (3-9305343) tRNA-Leu
    1474. Escherichia coli HVH 213 (4-3042928) tRNA-Leu
    1475. Escherichia coli HVH 214 (4-3062198) tRNA-Leu
    1476. Escherichia coli HVH 21 (4-4517873) (4-4517873) tRNA-Leu
    1477. Escherichia coli HVH 215 (4-3008371) tRNA-Leu
    1478. Escherichia coli HVH 216 (4-3042952) tRNA-Leu
    1479. Escherichia coli HVH 217 (4-1022806) tRNA-Leu
    1480. Escherichia coli HVH 218 (4-4500903) tRNA-Leu
    1481. Escherichia coli HVH 220 (4-5876842) tRNA-Leu
    1482. Escherichia coli HVH 221 (4-3136817) tRNA-Leu
    1483. Escherichia coli HVH 222 (4-2977443) tRNA-Leu
    1484. Escherichia coli HVH 223 (4-2976528) tRNA-Leu
    1485. Escherichia coli HVH 22 (4-2258986) (4-2258986) tRNA-Leu
    1486. Escherichia coli HVH 225 (4-1273116) tRNA-Leu
    1487. Escherichia coli HVH 227 (4-2277670) tRNA-Leu
    1488. Escherichia coli HVH 228 (4-7787030) tRNA-Leu
    1489. Escherichia coli HVH 23 (4-6066488) tRNA-Leu
    1490. Escherichia coli HVH 24 (4-5985145) tRNA-Leu
    1491. Escherichia coli HVH 2 (4-6943160) tRNA-Leu
    1492. Escherichia coli HVH 25 (4-5851939) tRNA-Leu
    1493. Escherichia coli HVH 26 (4-5703913) tRNA-Leu
    1494. Escherichia coli HVH 27 (4-7449267) tRNA-Leu
    1495. Escherichia coli HVH 28 (4-0907367) tRNA-Leu
    1496. Escherichia coli HVH 29 (4-3418073) tRNA-Leu
    1497. Escherichia coli HVH 30 (4-2661829) (4-2661829) tRNA-Leu
    1498. Escherichia coli HVH 31 (4-2602156) tRNA-Leu
    1499. Escherichia coli HVH 32 (4-3773988) tRNA-Leu
    1500. Escherichia coli HVH 33 (4-2174936) tRNA-Leu
    1501. Escherichia coli HVH 3 (4-7276001) (4-7276001) tRNA-Leu
    1502. Escherichia coli HVH 35 (4-2962667) tRNA-Leu
    1503. Escherichia coli HVH 36 (4-5675286) tRNA-Leu
    1504. Escherichia coli HVH 37 (4-2773848) tRNA-Leu
    1505. Escherichia coli HVH 38 (4-2774682) tRNA-Leu
    1506. Escherichia coli HVH 39 (4-2679949) tRNA-Leu
    1507. Escherichia coli HVH 40 (4-1219782) tRNA-Leu
    1508. Escherichia coli HVH 41 (4-2677849) tRNA-Leu
    1509. Escherichia coli HVH 42 (4-2100061) tRNA-Leu
    1510. Escherichia coli HVH 43 (4-2173468) tRNA-Leu
    1511. Escherichia coli HVH 44 (4-2298570) tRNA-Leu
    1512. Escherichia coli HVH 4 (4-7276109) tRNA-Leu
    1513. Escherichia coli HVH 45 (4-3129918) tRNA-Leu
    1514. Escherichia coli HVH 46 (4-2758776) tRNA-Leu
    1515. Escherichia coli HVH 48 (4-2658593) tRNA-Leu
    1516. Escherichia coli HVH 50 (4-2593475) tRNA-Leu
    1517. Escherichia coli HVH 51 (4-2172526) tRNA-Leu
    1518. Escherichia coli HVH 53 (4-0631051) tRNA-Leu
    1519. Escherichia coli HVH 5 (4-7148410) tRNA-Leu
    1520. Escherichia coli HVH 55 (4-2646161) tRNA-Leu
    1521. Escherichia coli HVH 56 (4-2153033) tRNA-Leu
    1522. Escherichia coli HVH 58 (4-2839709) tRNA-Leu
    1523. Escherichia coli HVH 59 (4-1119338) tRNA-Leu
    1524. Escherichia coli HVH 61 (4-2736020) tRNA-Leu
    1525. Escherichia coli HVH 63 (4-2542528) (4-2542528) tRNA-Leu
    1526. Escherichia coli HVH 6 (3-8296502) (3-8296502) tRNA-Leu
    1527. Escherichia coli HVH 65 (4-2262045) tRNA-Leu
    1528. Escherichia coli HVH 68 (4-0888028) tRNA-Leu
    1529. Escherichia coli HVH 69 (4-2837072) tRNA-Leu
    1530. Escherichia coli HVH 70 (4-2963531) (4-2963531) tRNA-Leu
    1531. Escherichia coli HVH 73 (4-2393174) tRNA-Leu
    1532. Escherichia coli HVH 74 (4-1034782) tRNA-Leu
    1533. Escherichia coli HVH 7 (4-7315031) tRNA-Leu
    1534. Escherichia coli HVH 76 (4-2538717) tRNA-Leu
    1535. Escherichia coli HVH 77 (4-2605759) tRNA-Leu
    1536. Escherichia coli HVH 78 (4-2735946) tRNA-Leu
    1537. Escherichia coli HVH 79 (4-2512823) (4-2512823) tRNA-Leu
    1538. Escherichia coli HVH 80 (4-2428830) tRNA-Leu
    1539. Escherichia coli HVH 83 (4-2051087) (4-2051087) tRNA-Leu
    1540. Escherichia coli HVH 84 (4-1021478) tRNA-Leu
    1541. Escherichia coli HVH 85 (4-0792144) (4-0792144) tRNA-Leu
    1542. Escherichia coli HVH 86 (4-7026218) tRNA-Leu
    1543. Escherichia coli HVH 87 (4-5977630) tRNA-Leu
    1544. Escherichia coli HVH 88 (4-5854636) tRNA-Leu
    1545. Escherichia coli HVH 89 (4-5885604) tRNA-Leu
    1546. Escherichia coli HVH 90 (4-3191362) tRNA-Leu
    1547. Escherichia coli HVH 91 (4-4638751) tRNA-Leu
    1548. Escherichia coli HVH 92 (4-5930790) tRNA-Leu
    1549. Escherichia coli HVH 9 (4-6942539) tRNA-Leu
    1550. Escherichia coli HVH 95 (4-6074464) (4-6074464) tRNA-Leu
    1551. Escherichia coli HVH 96 (4-5934869) tRNA-Leu
    1552. Escherichia coli HVH 98 (4-5799287) tRNA-Leu
    1553. Escherichia coli IAI1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1554. Escherichia coli IAI39 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1555. Escherichia coli IHE3034 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1556. Escherichia coli J53 tRNA-Leu
    1557. Escherichia coli J96 tRNA-Leu
    1558. Escherichia coli JB1-95 tRNA-Leu
    1559. Escherichia coli JJ1886 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1560. Escherichia coli JJ1887 tRNA-Leu
    1561. Escherichia coli Jurua 18/11 tRNA-Leu
    1562. Escherichia coli Jurua 20/10 tRNA-Leu
    1563. Escherichia coli K02 tRNA-Leu
    1564. Escherichia coli K-12 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1565. Escherichia coli K71 tRNA-Leu
    1566. Escherichia coli KD1 tRNA-Leu
    1567. Escherichia coli KD2 tRNA-Leu
    1568. Escherichia coli KLY tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1569. Escherichia coli KO11FL tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1570. Escherichia coli KOEGE 10 (25a) tRNA-Leu
    1571. Escherichia coli KOEGE 118 (317a) tRNA-Leu
    1572. Escherichia coli KOEGE 131 (358a) tRNA-Leu
    1573. Escherichia coli KOEGE 30 (63a) tRNA-Leu
    1574. Escherichia coli KOEGE 32 (66a) tRNA-Leu
    1575. Escherichia coli KOEGE 33 (68a) tRNA-Leu
    1576. Escherichia coli KOEGE 3 (4a) tRNA-Leu
    1577. Escherichia coli KOEGE 40 (102a) tRNA-Leu
    1578. Escherichia coli KOEGE 43 (105a) (105a) tRNA-Leu
    1579. Escherichia coli KOEGE 44 (106a) tRNA-Leu
    1580. Escherichia coli KOEGE 56 (169a) tRNA-Leu
    1581. Escherichia coli KOEGE 58 (171a) tRNA-Leu
    1582. Escherichia coli KOEGE 61 (174a) tRNA-Leu
    1583. Escherichia coli KOEGE 62 (175a) tRNA-Leu
    1584. Escherichia coli KOEGE 68 (182a) tRNA-Leu
    1585. Escherichia coli KOEGE 70 (185a) tRNA-Leu
    1586. Escherichia coli KOEGE 71 (186a) tRNA-Leu
    1587. Escherichia coli KOEGE 7 (16a) tRNA-Leu
    1588. Escherichia coli KOEGE 73 (195a) tRNA-Leu
    1589. Escherichia coli KOEGE 77 (202a) (202a) tRNA-Leu
    1590. Escherichia coli KTE100 tRNA-Leu
    1591. Escherichia coli KTE101 tRNA-Leu
    1592. Escherichia coli KTE102 tRNA-Leu
    1593. Escherichia coli KTE103 tRNA-Leu
    1594. Escherichia coli KTE104 tRNA-Leu
    1595. Escherichia coli KTE106 tRNA-Leu
    1596. Escherichia coli KTE107 tRNA-Leu
    1597. Escherichia coli KTE108 tRNA-Leu
    1598. Escherichia coli KTE109 tRNA-Leu
    1599. Escherichia coli KTE10 tRNA-Leu
    1600. Escherichia coli KTE111 tRNA-Leu
    1601. Escherichia coli KTE112 tRNA-Leu
    1602. Escherichia coli KTE113 tRNA-Leu
    1603. Escherichia coli KTE115 tRNA-Leu
    1604. Escherichia coli KTE116 tRNA-Leu
    1605. Escherichia coli KTE117 tRNA-Leu
    1606. Escherichia coli KTE118 tRNA-Leu
    1607. Escherichia coli KTE119 tRNA-Leu
    1608. Escherichia coli KTE120 tRNA-Leu
    1609. Escherichia coli KTE122 tRNA-Leu
    1610. Escherichia coli KTE123 tRNA-Leu
    1611. Escherichia coli KTE124 tRNA-Leu
    1612. Escherichia coli KTE125 tRNA-Leu
    1613. Escherichia coli KTE126 tRNA-Leu
    1614. Escherichia coli KTE127 tRNA-Leu
    1615. Escherichia coli KTE128 tRNA-Leu
    1616. Escherichia coli KTE129 tRNA-Leu
    1617. Escherichia coli KTE12 tRNA-Leu
    1618. Escherichia coli KTE130 tRNA-Leu
    1619. Escherichia coli KTE131 tRNA-Leu
    1620. Escherichia coli KTE132 tRNA-Leu
    1621. Escherichia coli KTE133 tRNA-Leu
    1622. Escherichia coli KTE134 tRNA-Leu
    1623. Escherichia coli KTE135 tRNA-Leu
    1624. Escherichia coli KTE136 tRNA-Leu
    1625. Escherichia coli KTE137 tRNA-Leu
    1626. Escherichia coli KTE138 tRNA-Leu
    1627. Escherichia coli KTE139 tRNA-Leu
    1628. Escherichia coli KTE13 tRNA-Leu
    1629. Escherichia coli KTE140 tRNA-Leu
    1630. Escherichia coli KTE141 tRNA-Leu
    1631. Escherichia coli KTE142 tRNA-Leu
    1632. Escherichia coli KTE143 tRNA-Leu
    1633. Escherichia coli KTE144 tRNA-Leu
    1634. Escherichia coli KTE145 tRNA-Leu
    1635. Escherichia coli KTE146 tRNA-Leu
    1636. Escherichia coli KTE147 tRNA-Leu
    1637. Escherichia coli KTE148 tRNA-Leu
    1638. Escherichia coli KTE14 tRNA-Leu
    1639. Escherichia coli KTE150 tRNA-Leu
    1640. Escherichia coli KTE153 tRNA-Leu
    1641. Escherichia coli KTE154 tRNA-Leu
    1642. Escherichia coli KTE155 tRNA-Leu
    1643. Escherichia coli KTE156 tRNA-Leu
    1644. Escherichia coli KTE157 tRNA-Leu
    1645. Escherichia coli KTE158 tRNA-Leu
    1646. Escherichia coli KTE15 tRNA-Leu
    1647. Escherichia coli KTE160 tRNA-Leu
    1648. Escherichia coli KTE161 tRNA-Leu
    1649. Escherichia coli KTE162 tRNA-Leu
    1650. Escherichia coli KTE163 tRNA-Leu
    1651. Escherichia coli KTE165 tRNA-Leu
    1652. Escherichia coli KTE166 tRNA-Leu
    1653. Escherichia coli KTE167 tRNA-Leu
    1654. Escherichia coli KTE168 tRNA-Leu
    1655. Escherichia coli KTE169 tRNA-Leu
    1656. Escherichia coli KTE16 tRNA-Leu
    1657. Escherichia coli KTE170 tRNA-Leu
    1658. Escherichia coli KTE171 tRNA-Leu
    1659. Escherichia coli KTE173 tRNA-Leu
    1660. Escherichia coli KTE174 tRNA-Leu
    1661. Escherichia coli KTE175 tRNA-Leu
    1662. Escherichia coli KTE176 tRNA-Leu
    1663. Escherichia coli KTE177 tRNA-Leu
    1664. Escherichia coli KTE178 tRNA-Leu
    1665. Escherichia coli KTE179 tRNA-Leu
    1666. Escherichia coli KTE17 tRNA-Leu
    1667. Escherichia coli KTE180 tRNA-Leu
    1668. Escherichia coli KTE181 tRNA-Leu
    1669. Escherichia coli KTE182 tRNA-Leu
    1670. Escherichia coli KTE183 tRNA-Leu
    1671. Escherichia coli KTE184 tRNA-Leu
    1672. Escherichia coli KTE185 tRNA-Leu
    1673. Escherichia coli KTE186 tRNA-Leu
    1674. Escherichia coli KTE187 tRNA-Leu
    1675. Escherichia coli KTE188 tRNA-Leu
    1676. Escherichia coli KTE189 tRNA-Leu
    1677. Escherichia coli KTE18 tRNA-Leu
    1678. Escherichia coli KTE190 tRNA-Leu
    1679. Escherichia coli KTE191 tRNA-Leu
    1680. Escherichia coli KTE192 tRNA-Leu
    1681. Escherichia coli KTE193 tRNA-Leu
    1682. Escherichia coli KTE194 tRNA-Leu
    1683. Escherichia coli KTE195 tRNA-Leu
    1684. Escherichia coli KTE196 tRNA-Leu
    1685. Escherichia coli KTE197 tRNA-Leu
    1686. Escherichia coli KTE198 tRNA-Leu
    1687. Escherichia coli KTE199 tRNA-Leu
    1688. Escherichia coli KTE19 tRNA-Leu
    1689. Escherichia coli KTE1 tRNA-Leu
    1690. Escherichia coli KTE200 tRNA-Leu
    1691. Escherichia coli KTE201 tRNA-Leu
    1692. Escherichia coli KTE202 tRNA-Leu
    1693. Escherichia coli KTE203 tRNA-Leu
    1694. Escherichia coli KTE204 tRNA-Leu
    1695. Escherichia coli KTE205 tRNA-Leu
    1696. Escherichia coli KTE206 tRNA-Leu
    1697. Escherichia coli KTE207 tRNA-Leu
    1698. Escherichia coli KTE208 tRNA-Leu
    1699. Escherichia coli KTE209 tRNA-Leu
    1700. Escherichia coli KTE20 tRNA-Leu
    1701. Escherichia coli KTE210 tRNA-Leu
    1702. Escherichia coli KTE211 tRNA-Leu
    1703. Escherichia coli KTE212 tRNA-Leu
    1704. Escherichia coli KTE213 tRNA-Leu
    1705. Escherichia coli KTE214 tRNA-Leu
    1706. Escherichia coli KTE215 tRNA-Leu
    1707. Escherichia coli KTE216 tRNA-Leu
    1708. Escherichia coli KTE218 tRNA-Leu
    1709. Escherichia coli KTE219 tRNA-Leu
    1710. Escherichia coli KTE21 tRNA-Leu
    1711. Escherichia coli KTE220 tRNA-Leu
    1712. Escherichia coli KTE221 tRNA-Leu
    1713. Escherichia coli KTE222 tRNA-Leu
    1714. Escherichia coli KTE223 tRNA-Leu
    1715. Escherichia coli KTE224 tRNA-Leu
    1716. Escherichia coli KTE225 tRNA-Leu
    1717. Escherichia coli KTE226 tRNA-Leu
    1718. Escherichia coli KTE227 tRNA-Leu
    1719. Escherichia coli KTE228 tRNA-Leu
    1720. Escherichia coli KTE229 tRNA-Leu
    1721. Escherichia coli KTE22 tRNA-Leu
    1722. Escherichia coli KTE230 tRNA-Leu
    1723. Escherichia coli KTE231 tRNA-Leu
    1724. Escherichia coli KTE232 tRNA-Leu
    1725. Escherichia coli KTE233 tRNA-Leu
    1726. Escherichia coli KTE234 tRNA-Leu
    1727. Escherichia coli KTE235 tRNA-Leu
    1728. Escherichia coli KTE236 tRNA-Leu
    1729. Escherichia coli KTE237 tRNA-Leu
    1730. Escherichia coli KTE23 tRNA-Leu
    1731. Escherichia coli KTE240 tRNA-Leu
    1732. Escherichia coli KTE24 tRNA-Leu
    1733. Escherichia coli KTE25 tRNA-Leu
    1734. Escherichia coli KTE26 tRNA-Leu
    1735. Escherichia coli KTE27 tRNA-Leu
    1736. Escherichia coli KTE28 tRNA-Leu
    1737. Escherichia coli KTE29 tRNA-Leu
    1738. Escherichia coli KTE2 tRNA-Leu
    1739. Escherichia coli KTE33 tRNA-Leu
    1740. Escherichia coli KTE34 tRNA-Leu
    1741. Escherichia coli KTE35 tRNA-Leu
    1742. Escherichia coli KTE36 tRNA-Leu
    1743. Escherichia coli KTE37 tRNA-Leu
    1744. Escherichia coli KTE39 tRNA-Leu
    1745. Escherichia coli KTE3 tRNA-Leu
    1746. Escherichia coli KTE40 tRNA-Leu
    1747. Escherichia coli KTE41 tRNA-Leu
    1748. Escherichia coli KTE42 tRNA-Leu
    1749. Escherichia coli KTE43 tRNA-Leu
    1750. Escherichia coli KTE44 tRNA-Leu
    1751. Escherichia coli KTE45 tRNA-Leu
    1752. Escherichia coli KTE47 tRNA-Leu
    1753. Escherichia coli KTE48 tRNA-Leu
    1754. Escherichia coli KTE49 tRNA-Leu
    1755. Escherichia coli KTE4 tRNA-Leu
    1756. Escherichia coli KTE50 tRNA-Leu
    1757. Escherichia coli KTE51 tRNA-Leu
    1758. Escherichia coli KTE53 tRNA-Leu
    1759. Escherichia coli KTE54 tRNA-Leu
    1760. Escherichia coli KTE55 tRNA-Leu
    1761. Escherichia coli KTE56 tRNA-Leu
    1762. Escherichia coli KTE57 tRNA-Leu
    1763. Escherichia coli KTE58 tRNA-Leu
    1764. Escherichia coli KTE59 tRNA-Leu
    1765. Escherichia coli KTE5 tRNA-Leu
    1766. Escherichia coli KTE60 tRNA-Leu
    1767. Escherichia coli KTE62 tRNA-Leu
    1768. Escherichia coli KTE63 tRNA-Leu
    1769. Escherichia coli KTE64 tRNA-Leu
    1770. Escherichia coli KTE65 tRNA-Leu
    1771. Escherichia coli KTE67 tRNA-Leu
    1772. Escherichia coli KTE68 tRNA-Leu
    1773. Escherichia coli KTE69 tRNA-Leu
    1774. Escherichia coli KTE6 tRNA-Leu
    1775. Escherichia coli KTE70 tRNA-Leu
    1776. Escherichia coli KTE71 tRNA-Leu
    1777. Escherichia coli KTE72 tRNA-Leu
    1778. Escherichia coli KTE73 tRNA-Leu
    1779. Escherichia coli KTE74 tRNA-Leu
    1780. Escherichia coli KTE75 tRNA-Leu
    1781. Escherichia coli KTE76 tRNA-Leu
    1782. Escherichia coli KTE77 tRNA-Leu
    1783. Escherichia coli KTE78 tRNA-Leu
    1784. Escherichia coli KTE79 tRNA-Leu
    1785. Escherichia coli KTE7 tRNA-Leu
    1786. Escherichia coli KTE80 tRNA-Leu
    1787. Escherichia coli KTE81 tRNA-Leu
    1788. Escherichia coli KTE82 tRNA-Leu
    1789. Escherichia coli KTE83 tRNA-Leu
    1790. Escherichia coli KTE84 tRNA-Leu
    1791. Escherichia coli KTE85 tRNA-Leu
    1792. Escherichia coli KTE86 tRNA-Leu
    1793. Escherichia coli KTE87 tRNA-Leu
    1794. Escherichia coli KTE88 tRNA-Leu
    1795. Escherichia coli KTE89 tRNA-Leu
    1796. Escherichia coli KTE8 tRNA-Leu
    1797. Escherichia coli KTE90 tRNA-Leu
    1798. Escherichia coli KTE91 tRNA-Leu
    1799. Escherichia coli KTE93 tRNA-Leu
    1800. Escherichia coli KTE94 tRNA-Leu
    1801. Escherichia coli KTE95 tRNA-Leu
    1802. Escherichia coli KTE97 tRNA-Leu
    1803. Escherichia coli KTE98 tRNA-Leu
    1804. Escherichia coli KTE99 tRNA-Leu
    1805. Escherichia coli KTE9 tRNA-Leu
    1806. Escherichia coli LAU-EC10 tRNA-Leu
    1807. Escherichia coli LAU-EC6 tRNA-Leu
    1808. Escherichia coli LAU-EC7 tRNA-Leu
    1809. Escherichia coli LAU-EC8 tRNA-Leu
    1810. Escherichia coli LAU-EC9 tRNA-Leu
    1811. Escherichia coli LF82 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1812. Escherichia coli LT-68 tRNA-Leu
    1813. Escherichia coli LY180 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1814. Escherichia coli M056 tRNA-Leu
    1815. Escherichia coli M114 tRNA-Leu
    1816. Escherichia coli M12 tRNA-Leu
    1817. Escherichia coli M4 tRNA-Leu
    1818. Escherichia coli M605 tRNA-Leu
    1819. Escherichia coli M718 tRNA-Leu
    1820. Escherichia coli M863 tRNA-Leu
    1821. Escherichia coli M8 tRNA-Leu
    1822. Escherichia coli M919 tRNA-Leu
    1823. Escherichia coli MA6 tRNA-Leu
    1824. Escherichia coli MGH 57 tRNA-Leu
    1825. Escherichia coli MGH 58 tRNA-Leu
    1826. Escherichia coli MP020940.1 tRNA-Leu
    1827. Escherichia coli MP020980.1 tRNA-Leu
    1828. Escherichia coli MP020980.2 tRNA-Leu
    1829. Escherichia coli MP021017.10 tRNA-Leu
    1830. Escherichia coli MP021017.11 tRNA-Leu
    1831. Escherichia coli MP021017.12 tRNA-Leu
    1832. Escherichia coli MP021017.1 tRNA-Leu
    1833. Escherichia coli MP021017.2 tRNA-Leu
    1834. Escherichia coli MP021017.3 tRNA-Leu
    1835. Escherichia coli MP021017.4 tRNA-Leu
    1836. Escherichia coli MP021017.5 tRNA-Leu
    1837. Escherichia coli MP021017.6 tRNA-Leu
    1838. Escherichia coli MP021017.9 tRNA-Leu
    1839. Escherichia coli MP021552.11 tRNA-Leu
    1840. Escherichia coli MP021552.12 tRNA-Leu
    1841. Escherichia coli MP021552.7 tRNA-Leu
    1842. Escherichia coli MP021552.8 tRNA-Leu
    1843. Escherichia coli MP021561.2 tRNA-Leu
    1844. Escherichia coli MP021561.3 tRNA-Leu
    1845. Escherichia coli MP021566.1 tRNA-Leu
    1846. Escherichia coli MP1 tRNA-Leu
    1847. Escherichia coli MRSN 10204 tRNA-Leu
    1848. Escherichia coli MS 107-1 tRNA-Leu
    1849. Escherichia coli MS 110-3 tRNA-Leu
    1850. Escherichia coli MS 115-1 tRNA-Leu
    1851. Escherichia coli MS 116-1 tRNA-Leu
    1852. Escherichia coli MS 117-3 tRNA-Leu
    1853. Escherichia coli MS 119-7 tRNA-Leu
    1854. Escherichia coli MS 124-1 tRNA-Leu
    1855. Escherichia coli MS 145-7 tRNA-Leu
    1856. Escherichia coli MS 146-1 tRNA-Leu
    1857. Escherichia coli MS 153-1 tRNA-Leu
    1858. Escherichia coli MS 16-3 tRNA-Leu
    1859. Escherichia coli MS 175-1 tRNA-Leu
    1860. Escherichia coli MS 182-1 tRNA-Leu
    1861. Escherichia coli MS 185-1 tRNA-Leu
    1862. Escherichia coli MS 187-1 tRNA-Leu
    1863. Escherichia coli MS 196-1 tRNA-Leu
    1864. Escherichia coli MS 198-1 tRNA-Leu
    1865. Escherichia coli MS 200-1 tRNA-Leu
    1866. Escherichia coli MS 21-1 tRNA-Leu
    1867. Escherichia coli MS 45-1 tRNA-Leu
    1868. Escherichia coli MS 57-2 tRNA-Leu
    1869. Escherichia coli MS 60-1 tRNA-Leu
    1870. Escherichia coli MS 69-1 tRNA-Leu
    1871. Escherichia coli MS 78-1 tRNA-Leu
    1872. Escherichia coli MS 79-10 tRNA-Leu
    1873. Escherichia coli MS 84-1 tRNA-Leu
    1874. Escherichia coli MS 85-1 tRNA-Leu
    1875. Escherichia coli N1 tRNA-Leu
    1876. Escherichia coli N36254PS tRNA-Leu
    1877. Escherichia coli N36410PS tRNA-Leu
    1878. Escherichia coli N37058PS tRNA-Leu
    1879. Escherichia coli N37122PS tRNA-Leu
    1880. Escherichia coli N37139PS tRNA-Leu
    1881. Escherichia coli N40513 tRNA-Leu
    1882. Escherichia coli N40607 tRNA-Leu
    1883. Escherichia coli NA114 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1884. Escherichia coli NB8 tRNA-Leu
    1885. Escherichia coli NC101 tRNA-Leu
    1886. Escherichia coli NCCP15648 tRNA-Leu
    1887. Escherichia coli NCTC 50110 tRNA-Leu
    1888. Escherichia coli NE037 tRNA-Leu
    1889. Escherichia coli NE098 tRNA-Leu
    1890. Escherichia coli NE1487 tRNA-Leu
    1891. Escherichia coli Nissle 1917 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1892. Escherichia coli NU14 tRNA-Leu
    1893. Escherichia coli O08 tRNA-Leu
    1894. Escherichia coli O100:H21 tRNA-Leu
    1895. Escherichia coli O100 tRNA-Leu
    1896. Escherichia coli O101 tRNA-Leu
    1897. Escherichia coli O102 tRNA-Leu
    1898. Escherichia coli O103:H11 str. 04-3023 tRNA-Leu
    1899. Escherichia coli O103:H11 str. 2010C-3214 tRNA-Leu
    1900. Escherichia coli O103:H25 str. 2010C-4529 tRNA-Leu
    1901. Escherichia coli O103:H25 str. CVM9340 tRNA-Leu
    1902. Escherichia coli O103:H2 str. 12009 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1903. Escherichia coli O103:H2 str. 2009C-3279 tRNA-Leu
    1904. Escherichia coli O103:H2 str. 2010C-4433 tRNA-Leu
    1905. Escherichia coli O103:H2 str. 2011C-3750 tRNA-Leu
    1906. Escherichia coli O103:H2 str. CVM9450 tRNA-Leu
    1907. Escherichia coli O103:H2 tRNA-Leu
    1908. Escherichia coli O103 str. RM8385 tRNA-Leu
    1909. Escherichia coli O103 tRNA-Leu
    1910. Escherichia coli O104:H21 str. 94-3025 tRNA-Leu
    1911. Escherichia coli O104:H21 str. CFSAN002236 tRNA-Leu
    1912. Escherichia coli O104:H21 str. CFSAN002237 tRNA-Leu
    1913. Escherichia coli O104:H4 str. 01-09591 tRNA-Leu
    1914. Escherichia coli O104:H4 str. 04-8351 tRNA-Leu
    1915. Escherichia coli O104:H4 str. 09-7901 tRNA-Leu
    1916. Escherichia coli O104:H4 str. 11-02030 tRNA-Leu
    1917. Escherichia coli O104:H4 str. 11-02033-1 tRNA-Leu
    1918. Escherichia coli O104:H4 str. 11-02092 tRNA-Leu
    1919. Escherichia coli O104:H4 str. 11-02093 tRNA-Leu
    1920. Escherichia coli O104:H4 str. 11-02281 tRNA-Leu
    1921. Escherichia coli O104:H4 str. 11-02318 tRNA-Leu
    1922. Escherichia coli O104:H4 str. 11-02913 tRNA-Leu
    1923. Escherichia coli O104:H4 str. 11-03439 tRNA-Leu
    1924. Escherichia coli O104:H4 str. 11-03943 tRNA-Leu
    1925. Escherichia coli O104:H4 str. 11-04080 tRNA-Leu
    1926. Escherichia coli O104:H4 str. 11-3677 tRNA-Leu
    1927. Escherichia coli O104:H4 str. 11-4404 tRNA-Leu
    1928. Escherichia coli O104:H4 str. 11-4522 tRNA-Leu
    1929. Escherichia coli O104:H4 str. 11-4623 tRNA-Leu
    1930. Escherichia coli O104:H4 str. 11-4632 C1 tRNA-Leu
    1931. Escherichia coli O104:H4 str. 11-4632 C2 tRNA-Leu
    1932. Escherichia coli O104:H4 str. 11-4632 C3 tRNA-Leu
    1933. Escherichia coli O104:H4 str. 11-4632 C4 tRNA-Leu
    1934. Escherichia coli O104:H4 str. 11-4632 C5 tRNA-Leu
    1935. Escherichia coli O104:H4 str. 2009EL-2050 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1936. Escherichia coli O104:H4 str. 2009EL-2071 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1937. Escherichia coli O104:H4 str. 2011C-3493 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1938. Escherichia coli O104:H4 str. 2011EL-1675A tRNA-Leu
    1939. Escherichia coli O104:H4 str. C227-11 tRNA-Leu
    1940. Escherichia coli O104:H4 str. C236-11 tRNA-Leu
    1941. Escherichia coli O104:H4 str. E112/10 tRNA-Leu
    1942. Escherichia coli O104:H4 str. E92/11 tRNA-Leu
    1943. Escherichia coli O104:H4 str. Ec11-4984 tRNA-Leu
    1944. Escherichia coli O104:H4 str. Ec11-4986 tRNA-Leu
    1945. Escherichia coli O104:H4 str. Ec11-4987 tRNA-Leu
    1946. Escherichia coli O104:H4 str. Ec11-4988 tRNA-Leu
    1947. Escherichia coli O104:H4 str. Ec11-5603 tRNA-Leu
    1948. Escherichia coli O104:H4 str. Ec11-5604 tRNA-Leu
    1949. Escherichia coli O104:H4 str. Ec11-6006 tRNA-Leu
    1950. Escherichia coli O104:H4 str. Ec11-9450 tRNA-Leu
    1951. Escherichia coli O104:H4 str. Ec11-9941 tRNA-Leu
    1952. Escherichia coli O104:H4 str. Ec11-9990 tRNA-Leu
    1953. Escherichia coli O104:H4 str. Ec12-0465 tRNA-Leu
    1954. Escherichia coli O104:H4 str. Ec12-0466 tRNA-Leu
    1955. Escherichia coli O104:H4 str. LB226692 tRNA-Leu
    1956. Escherichia coli O104:H4 tRNA-Leu
    1957. Escherichia coli O105 tRNA-Leu
    1958. Escherichia coli O106 tRNA-Leu
    1959. Escherichia coli O108:H9 tRNA-Leu
    1960. Escherichia coli O109 tRNA-Leu
    1961. Escherichia coli O10:H32 tRNA-Leu
    1962. Escherichia coli O10:K5(L):H4 str. ATCC 23506 tRNA-Leu-TAG
    1963. Escherichia coli O10 tRNA-Leu
    1964. Escherichia coli O110 tRNA-Leu
    1965. Escherichia coli O111:H11 str. CFSAN001630 tRNA-Leu
    1966. Escherichia coli O111:H11 str. CVM9455 tRNA-Leu
    1967. Escherichia coli O111:H11 str. CVM9534 tRNA-Leu
    1968. Escherichia coli O111:H11 str. CVM9545 tRNA-Leu
    1969. Escherichia coli O111:H8 str. 2009C-4126 tRNA-Leu
    1970. Escherichia coli O111:H8 str. 2009EL-2169 tRNA-Leu
    1971. Escherichia coli O111:H8 str. 2011C-3453 tRNA-Leu
    1972. Escherichia coli O111:H8 str. CFSAN001632 tRNA-Leu
    1973. Escherichia coli O111:H8 str. CVM9570 tRNA-Leu
    1974. Escherichia coli O111:H8 str. CVM9574 tRNA-Leu
    1975. Escherichia coli O111:H8 str. CVM9602 tRNA-Leu
    1976. Escherichia coli O111:H8 str. CVM9634 tRNA-Leu
    1977. Escherichia coli O111:H8 str. F6627 tRNA-Leu
    1978. Escherichia coli O111:H8 tRNA-Leu
    1979. Escherichia coli O111:H- str. 11128 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    1980. Escherichia coli O111:H- tRNA-Leu
    1981. Escherichia coli O111:NM str. 01-3076 tRNA-Leu
    1982. Escherichia coli O111:NM str. 03-3484 tRNA-Leu
    1983. Escherichia coli O111:NM str. 04-3211 tRNA-Leu
    1984. Escherichia coli O111:NM str. 08-4487 tRNA-Leu
    1985. Escherichia coli O111:NM str. 2009C-4006 tRNA-Leu
    1986. Escherichia coli O111:NM str. 2009C-4052 tRNA-Leu
    1987. Escherichia coli O111:NM str. 2010C-3053 tRNA-Leu
    1988. Escherichia coli O111:NM str. 2010C-3977 tRNA-Leu
    1989. Escherichia coli O111:NM str. 2010C-4086 tRNA-Leu
    1990. Escherichia coli O111:NM str. 2010C-4221 tRNA-Leu
    1991. Escherichia coli O111:NM str. 2010C-4592 tRNA-Leu
    1992. Escherichia coli O111:NM str. 2010C-4622 tRNA-Leu
    1993. Escherichia coli O111:NM str. 2010C-4715 tRNA-Leu
    1994. Escherichia coli O111:NM str. 2010C-4735 tRNA-Leu
    1995. Escherichia coli O111:NM str. 2010C-4746 tRNA-Leu
    1996. Escherichia coli O111:NM str. 2010C-4799 tRNA-Leu
    1997. Escherichia coli O111:NM str. 2010C-4818 tRNA-Leu
    1998. Escherichia coli O111:NM str. 2011C-3170 tRNA-Leu
    1999. Escherichia coli O111:NM str. 2011C-3362 tRNA-Leu
    2000. Escherichia coli O111:NM str. 2011C-3573 tRNA-Leu
    2001. Escherichia coli O111:NM str. 2011C-3632 tRNA-Leu
    2002. Escherichia coli O111:NM str. 2011C-3679 tRNA-Leu
    2003. Escherichia coli O111:NM str. K6722 tRNA-Leu
    2004. Escherichia coli O111:NM str. K6723 tRNA-Leu
    2005. Escherichia coli O111:NM str. K6728 tRNA-Leu
    2006. Escherichia coli O111:NM str. K6890 tRNA-Leu
    2007. Escherichia coli O111:NM str. K6895 tRNA-Leu
    2008. Escherichia coli O111:NM str. K6897 tRNA-Leu
    2009. Escherichia coli O111:NM str. K6898 tRNA-Leu
    2010. Escherichia coli O111:NM str. K6904 tRNA-Leu
    2011. Escherichia coli O111:NM str. K6908 tRNA-Leu
    2012. Escherichia coli O111:NM str. K6915 tRNA-Leu
    2013. Escherichia coli O111:NM tRNA-Leu
    2014. Escherichia coli O111 str. RM9322 tRNA-Leu
    2015. Escherichia coli O111 tRNA-Leu
    2016. Escherichia coli O112ab:H8 tRNA-Leu
    2017. Escherichia coli O113:H21 str. 07-4224 tRNA-Leu
    2018. Escherichia coli O113:H21 tRNA-Leu
    2019. Escherichia coli O113:H36 tRNA-Leu
    2020. Escherichia coli O113 tRNA-Leu
    2021. Escherichia coli O117 tRNA-Leu
    2022. Escherichia coli O118:H16 str. 06-3256 tRNA-Leu
    2023. Escherichia coli O118:H16 str. 06-3612 tRNA-Leu
    2024. Escherichia coli O118:H16 str. 07-4255 tRNA-Leu
    2025. Escherichia coli O118:H16 str. 08-3651 tRNA-Leu
    2026. Escherichia coli O118:H16 str. 2009C-4446 tRNA-Leu
    2027. Escherichia coli O119:H4 str. 03-3458 tRNA-Leu
    2028. Escherichia coli O119 tRNA-Leu
    2029. Escherichia coli O11:H15 tRNA-Leu
    2030. Escherichia coli O11 tRNA-Leu
    2031. Escherichia coli O120:H10 tRNA-Leu
    2032. Escherichia coli O121:H19 str. 03-3227 tRNA-Leu
    2033. Escherichia coli O121:H19 str. 06-3003 tRNA-Leu
    2034. Escherichia coli O121:H19 str. 06-3822 tRNA-Leu
    2035. Escherichia coli O121:H19 str. 2009C-4050 tRNA-Leu
    2036. Escherichia coli O121:H19 str. 2009C-4659 tRNA-Leu
    2037. Escherichia coli O121:H19 str. 2009C-4750 tRNA-Leu
    2038. Escherichia coli O121:H19 str. 2009EL1302 tRNA-Leu
    2039. Escherichia coli O121:H19 str. 2009EL1412 tRNA-Leu
    2040. Escherichia coli O121:H19 str. 2010C-3609 tRNA-Leu
    2041. Escherichia coli O121:H19 str. 2010C-3794 tRNA-Leu
    2042. Escherichia coli O121:H19 str. 2010C-3840 tRNA-Leu
    2043. Escherichia coli O121:H19 str. 2010C-4254 tRNA-Leu
    2044. Escherichia coli O121:H19 str. 2010C-4732 tRNA-Leu
    2045. Escherichia coli O121:H19 str. 2010C-4824 tRNA-Leu
    2046. Escherichia coli O121:H19 str. 2010C-4966 tRNA-Leu
    2047. Escherichia coli O121:H19 str. 2010C-4989 tRNA-Leu
    2048. Escherichia coli O121:H19 str. 2010EL1058 tRNA-Leu
    2049. Escherichia coli O121:H19 str. 2011C-3072 tRNA-Leu
    2050. Escherichia coli O121:H19 str. 2011C-3108 tRNA-Leu
    2051. Escherichia coli O121:H19 str. 2011C-3216 tRNA-Leu
    2052. Escherichia coli O121:H19 str. 2011C-3500 tRNA-Leu
    2053. Escherichia coli O121:H19 str. 2011C-3537 tRNA-Leu
    2054. Escherichia coli O121:H19 str. 2011C-3609 tRNA-Leu
    2055. Escherichia coli O121:H19 str. F6714 tRNA-Leu
    2056. Escherichia coli O121:H19 str. K5198 tRNA-Leu
    2057. Escherichia coli O121:H19 str. K5269 tRNA-Leu
    2058. Escherichia coli O121:H19 tRNA-Leu
    2059. Escherichia coli O121:H7 str. 2009C-3299 tRNA-Leu
    2060. Escherichia coli O121 str. RM8352 tRNA-Leu
    2061. Escherichia coli O121 tRNA-Leu
    2062. Escherichia coli O123:H11 str. 2009C-3307 tRNA-Leu
    2063. Escherichia coli O124 tRNA-Leu
    2064. Escherichia coli O126:H45 tRNA-Leu
    2065. Escherichia coli O126 tRNA-Leu
    2066. Escherichia coli O127:H27 str. C43/90 tRNA-Leu
    2067. Escherichia coli O127:H6 str. E2348/69 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2068. Escherichia coli O127:H6 tRNA-Leu
    2069. Escherichia coli O128ac:H12 tRNA-Leu
    2070. Escherichia coli O128:H2 str. 2011C-3317 tRNA-Leu
    2071. Escherichia coli O128:H42 tRNA-Leu
    2072. Escherichia coli O128 tRNA-Leu
    2073. Escherichia coli O130 tRNA-Leu
    2074. Escherichia coli O132 tRNA-Leu
    2075. Escherichia coli O136:H26 tRNA-Leu
    2076. Escherichia coli O139:H1 tRNA-Leu
    2077. Escherichia coli O139:H28 str. E24377A tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2078. Escherichia coli O13 tRNA-Leu
    2079. Escherichia coli O140 tRNA-Leu
    2080. Escherichia coli O141:H4 tRNA-Leu
    2081. Escherichia coli O143:H4 tRNA-Leu
    2082. Escherichia coli O144 tRNA-Leu
    2083. Escherichia coli O145:H25 str. 07-3858 tRNA-Leu
    2084. Escherichia coli O145:H25 tRNA-Leu
    2085. Escherichia coli O145:H28 str. 2009C-3292 tRNA-Leu
    2086. Escherichia coli O145:H28 str. 4865/96 tRNA-Leu
    2087. Escherichia coli O145:H28 str. RM12581 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2088. Escherichia coli O145:H28 str. RM12761 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2089. Escherichia coli O145:H28 str. RM13514 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2090. Escherichia coli O145:H28 str. RM13516 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2091. Escherichia coli O145:H28 tRNA-Leu
    2092. Escherichia coli O145:H34 tRNA-Leu
    2093. Escherichia coli O145:NM str. 06-3484 tRNA-Leu
    2094. Escherichia coli O145:NM str. 08-4270 tRNA-Leu
    2095. Escherichia coli O145:NM str. 2010C-3507 tRNA-Leu
    2096. Escherichia coli O145:NM str. 2010C-3508 tRNA-Leu
    2097. Escherichia coli O145:NM str. 2010C-3509 tRNA-Leu
    2098. Escherichia coli O145:NM str. 2010C-3510 tRNA-Leu
    2099. Escherichia coli O145:NM str. 2010C-3511 tRNA-Leu
    2100. Escherichia coli O145:NM str. 2010C-3516 tRNA-Leu
    2101. Escherichia coli O145:NM str. 2010C-3517 tRNA-Leu
    2102. Escherichia coli O145:NM str. 2010C-3518 tRNA-Leu
    2103. Escherichia coli O145:NM str. 2010C-3521 tRNA-Leu
    2104. Escherichia coli O145:NM str. 2010C-3526 tRNA-Leu
    2105. Escherichia coli O145:NM str. 2010C-4557C2 tRNA-Leu
    2106. Escherichia coli O145:NM tRNA-Leu
    2107. Escherichia coli O145 str. RM9872 tRNA-Leu
    2108. Escherichia coli O145 tRNA-Leu
    2109. Escherichia coli O146:H21 str. 2010C-3325 tRNA-Leu
    2110. Escherichia coli O146 tRNA-Leu
    2111. Escherichia coli O14 tRNA-Leu
    2112. Escherichia coli O150:H6 tRNA-Leu
    2113. Escherichia coli O150 tRNA-Leu
    2114. Escherichia coli O151:H8 tRNA-Leu
    2115. Escherichia coli O152:H23 tRNA-Leu
    2116. Escherichia coli O153:H12 tRNA-Leu
    2117. Escherichia coli O153:H2 str. 2010C-5034 tRNA-Leu
    2118. Escherichia coli O153 tRNA-Leu
    2119. Escherichia coli O156:H25 str. 2011C-3602 tRNA-Leu
    2120. Escherichia coli O157:H16 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2121. Escherichia coli O157:H7 str. 06-3745 tRNA-Leu
    2122. Escherichia coli O157:H7 str. 06-4039 tRNA-Leu
    2123. Escherichia coli O157:H7 str. 07-3091 tRNA-Leu
    2124. Escherichia coli O157:H7 str. 07-3391 tRNA-Leu
    2125. Escherichia coli O157:H7 str. 08-3037 tRNA-Leu
    2126. Escherichia coli O157:H7 str. 08-3527 tRNA-Leu
    2127. Escherichia coli O157:H7 str. 08-4169 tRNA-Leu
    2128. Escherichia coli O157:H7 str. 08-4529 tRNA-Leu
    2129. Escherichia coli O157:H7 str. 2009EL1449 tRNA-Leu
    2130. Escherichia coli O157:H7 str. 2009EL1705 tRNA-Leu
    2131. Escherichia coli O157:H7 str. 2009EL1913 tRNA-Leu
    2132. Escherichia coli O157:H7 str. 2009EL2109 tRNA-Leu
    2133. Escherichia coli O157:H7 str. 2010C-4979C1 tRNA-Leu
    2134. Escherichia coli O157:H7 str. 2011EL-1107 tRNA-Leu
    2135. Escherichia coli O157:H7 str. 2011EL-2090 tRNA-Leu
    2136. Escherichia coli O157:H7 str. 2011EL-2091 tRNA-Leu
    2137. Escherichia coli O157:H7 str. 2011EL-2092 tRNA-Leu
    2138. Escherichia coli O157:H7 str. 2011EL-2093 tRNA-Leu
    2139. Escherichia coli O157:H7 str. 2011EL-2094 tRNA-Leu
    2140. Escherichia coli O157:H7 str. 2011EL-2096 tRNA-Leu
    2141. Escherichia coli O157:H7 str. 2011EL-2097 tRNA-Leu
    2142. Escherichia coli O157:H7 str. 2011EL-2098 tRNA-Leu
    2143. Escherichia coli O157:H7 str. 2011EL-2099 tRNA-Leu
    2144. Escherichia coli O157:H7 str. 2011EL-2101 tRNA-Leu
    2145. Escherichia coli O157:H7 str. 2011EL-2103 tRNA-Leu
    2146. Escherichia coli O157:H7 str. 2011EL-2104 tRNA-Leu
    2147. Escherichia coli O157:H7 str. 2011EL-2105 tRNA-Leu
    2148. Escherichia coli O157:H7 str. 2011EL-2106 tRNA-Leu
    2149. Escherichia coli O157:H7 str. 2011EL-2107 tRNA-Leu
    2150. Escherichia coli O157:H7 str. 2011EL-2108 tRNA-Leu
    2151. Escherichia coli O157:H7 str. 2011EL-2109 tRNA-Leu
    2152. Escherichia coli O157:H7 str. 2011EL-2111 tRNA-Leu
    2153. Escherichia coli O157:H7 str. 2011EL-2112 tRNA-Leu
    2154. Escherichia coli O157:H7 str. 2011EL-2113 tRNA-Leu
    2155. Escherichia coli O157:H7 str. 2011EL-2114 tRNA-Leu
    2156. Escherichia coli O157:H7 str. 2011EL-2286 tRNA-Leu
    2157. Escherichia coli O157:H7 str. 2011EL-2287 tRNA-Leu
    2158. Escherichia coli O157:H7 str. 2011EL-2288 tRNA-Leu
    2159. Escherichia coli O157:H7 str. 2011EL-2289 tRNA-Leu
    2160. Escherichia coli O157:H7 str. 2011EL-2290 tRNA-Leu
    2161. Escherichia coli O157:H7 str. 2011EL-2312 tRNA-Leu
    2162. Escherichia coli O157:H7 str. 2011EL-2313 tRNA-Leu
    2163. Escherichia coli O157:H7 str. EC10 tRNA-Leu
    2164. Escherichia coli O157:H7 str. EC1825 tRNA-Leu
    2165. Escherichia coli O157:H7 str. EC4115 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2166. Escherichia coli O157:H7 str. EDL933 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2167. Escherichia coli O157:H7 str. F6142 tRNA-Leu
    2168. Escherichia coli O157:H7 str. F6749 tRNA-Leu
    2169. Escherichia coli O157:H7 str. F6750 tRNA-Leu
    2170. Escherichia coli O157:H7 str. F6751 tRNA-Leu
    2171. Escherichia coli O157:H7 str. F7350 tRNA-Leu
    2172. Escherichia coli O157:H7 str. F7377 tRNA-Leu
    2173. Escherichia coli O157:H7 str. F7384 tRNA-Leu
    2174. Escherichia coli O157:H7 str. F7410 tRNA-Leu
    2175. Escherichia coli O157:H7 str. F8092B tRNA-Leu
    2176. Escherichia coli O157:H7 str. G5101 tRNA-Leu
    2177. Escherichia coli O157:H7 str. G5303 tRNA-Leu
    2178. Escherichia coli O157:H7 str. H2495 tRNA-Leu
    2179. Escherichia coli O157:H7 str. H2498 tRNA-Leu
    2180. Escherichia coli O157:H7 str. K1420 tRNA-Leu
    2181. Escherichia coli O157:H7 str. K1792 tRNA-Leu
    2182. Escherichia coli O157:H7 str. K1793 tRNA-Leu
    2183. Escherichia coli O157:H7 str. K1795 tRNA-Leu
    2184. Escherichia coli O157:H7 str. K1796 tRNA-Leu
    2185. Escherichia coli O157:H7 str. K1845 tRNA-Leu
    2186. Escherichia coli O157:H7 str. K1921 tRNA-Leu
    2187. Escherichia coli O157:H7 str. K1927 tRNA-Leu
    2188. Escherichia coli O157:H7 str. K2188 tRNA-Leu
    2189. Escherichia coli O157:H7 str. K2191 tRNA-Leu
    2190. Escherichia coli O157:H7 str. K2192 tRNA-Leu
    2191. Escherichia coli O157:H7 str. K2324 tRNA-Leu
    2192. Escherichia coli O157:H7 str. K2581 tRNA-Leu
    2193. Escherichia coli O157:H7 str. K2622 tRNA-Leu
    2194. Escherichia coli O157:H7 str. K2845 tRNA-Leu
    2195. Escherichia coli O157:H7 str. K2854 tRNA-Leu
    2196. Escherichia coli O157:H7 str. K4396 tRNA-Leu
    2197. Escherichia coli O157:H7 str. K4405 tRNA-Leu
    2198. Escherichia coli O157:H7 str. K4406 tRNA-Leu
    2199. Escherichia coli O157:H7 str. K4527 tRNA-Leu
    2200. Escherichia coli O157:H7 str. K5418 tRNA-Leu
    2201. Escherichia coli O157:H7 str. K5448 tRNA-Leu
    2202. Escherichia coli O157:H7 str. K5449 tRNA-Leu
    2203. Escherichia coli O157:H7 str. K5453 tRNA-Leu
    2204. Escherichia coli O157:H7 str. K5460 tRNA-Leu
    2205. Escherichia coli O157:H7 str. K5467 tRNA-Leu
    2206. Escherichia coli O157:H7 str. K5602 tRNA-Leu
    2207. Escherichia coli O157:H7 str. K5607 tRNA-Leu
    2208. Escherichia coli O157:H7 str. K5609 tRNA-Leu
    2209. Escherichia coli O157:H7 str. K5806 tRNA-Leu
    2210. Escherichia coli O157:H7 str. K5852 tRNA-Leu
    2211. Escherichia coli O157:H7 str. K6590 tRNA-Leu
    2212. Escherichia coli O157:H7 str. K6676 tRNA-Leu
    2213. Escherichia coli O157:H7 str. K6687 tRNA-Leu
    2214. Escherichia coli O157:H7 str. K7140 tRNA-Leu
    2215. Escherichia coli O157:H7 str. LSU-61 tRNA-Leu
    2216. Escherichia coli O157:H7 str. Sakai tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2217. Escherichia coli O157:H7 str. SS17 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2218. Escherichia coli O157:H7 str. SS52 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2219. Escherichia coli O157:H7 str. TW14313 tRNA-Leu
    2220. Escherichia coli O157:H7 str. TW14359 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2221. Escherichia coli O157:H7 tRNA-Leu
    2222. Escherichia coli O157:H- str. 493-89 tRNA-Leu
    2223. Escherichia coli O157:H- str. H 2687 tRNA-Leu
    2224. Escherichia coli O157:H- tRNA-Leu
    2225. Escherichia coli O157:NM str. 08-4540 tRNA-Leu
    2226. Escherichia coli O157:NM tRNA-Leu
    2227. Escherichia coli O157: str. 2010EL-2044 tRNA-Leu
    2228. Escherichia coli O157: str. 2010EL-2045 tRNA-Leu
    2229. Escherichia coli O157 tRNA-Leu
    2230. Escherichia coli O158:H23 tRNA-Leu
    2231. Escherichia coli O159:H19 tRNA-Leu
    2232. Escherichia coli O15:H12 tRNA-Leu
    2233. Escherichia coli O15:H18 str. K1516 tRNA-Leu
    2234. Escherichia coli O15:H21 tRNA-Leu
    2235. Escherichia coli O15 tRNA-Leu
    2236. Escherichia coli O160 tRNA-Leu
    2237. Escherichia coli O163 tRNA-Leu
    2238. Escherichia coli O165:H25 str. 2010C-4874 tRNA-Leu
    2239. Escherichia coli O166:H49 tRNA-Leu
    2240. Escherichia coli O166:H6 tRNA-Leu
    2241. Escherichia coli O167:H26 tRNA-Leu
    2242. Escherichia coli O167:H9 tRNA-Leu
    2243. Escherichia coli O168:H8 tRNA-Leu
    2244. Escherichia coli O169:H41 str. F9792 tRNA-Leu
    2245. Escherichia coli O16:H48 tRNA-Leu
    2246. Escherichia coli O16 tRNA-Leu
    2247. Escherichia coli O170:H18 tRNA-Leu
    2248. Escherichia coli O174:H21 str. 03-3269 tRNA-Leu
    2249. Escherichia coli O174:H7 tRNA-Leu
    2250. Escherichia coli O174:H8 str. 04-3038 tRNA-Leu
    2251. Escherichia coli O176:H45 tRNA-Leu
    2252. Escherichia coli O177:NM str. 2010C-4558 tRNA-Leu
    2253. Escherichia coli O177 tRNA-Leu
    2254. Escherichia coli O180:H14 tRNA-Leu
    2255. Escherichia coli O18ac:H14 tRNA-Leu
    2256. Escherichia coli O18:H1 tRNA-Leu
    2257. Escherichia coli O18:H7 tRNA-Leu
    2258. Escherichia coli O19:H42 tRNA-Leu
    2259. Escherichia coli O19:H7 tRNA-Leu
    2260. Escherichia coli O19 tRNA-Leu
    2261. Escherichia coli O1:H42 tRNA-Leu
    2262. Escherichia coli O1:H7 tRNA-Leu
    2263. Escherichia coli O1:HNT tRNA-Leu
    2264. Escherichia coli O1 tRNA-Leu
    2265. Escherichia coli O20:H12 tRNA-Leu
    2266. Escherichia coli O21:H28 tRNA-Leu
    2267. Escherichia coli O21 tRNA-Leu
    2268. Escherichia coli O22:H8 tRNA-Leu
    2269. Escherichia coli O24 tRNA-Leu
    2270. Escherichia coli O25b:H4-ST131 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2271. Escherichia coli O25b:H4 tRNA-Leu
    2272. Escherichia coli O25:H4 tRNA-Leu
    2273. Escherichia coli O25:NM str. E2539C1 tRNA-Leu
    2274. Escherichia coli O25 tRNA-Leu
    2275. Escherichia coli O26:H11 str. 03-3500 tRNA-Leu
    2276. Escherichia coli O26:H11 str. 05-3646 tRNA-Leu
    2277. Escherichia coli O26:H11 str. 06-3464 tRNA-Leu
    2278. Escherichia coli O26:H11 str. 11368 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2279. Escherichia coli O26:H11 str. 2009C-3612 tRNA-Leu
    2280. Escherichia coli O26:H11 str. 2009C-3689 tRNA-Leu
    2281. Escherichia coli O26:H11 str. 2009C-3996 tRNA-Leu
    2282. Escherichia coli O26:H11 str. 2009C-4760 tRNA-Leu
    2283. Escherichia coli O26:H11 str. 2009C-4826 tRNA-Leu
    2284. Escherichia coli O26:H11 str. 2010C-3051 tRNA-Leu
    2285. Escherichia coli O26:H11 str. 2010C-3472 tRNA-Leu
    2286. Escherichia coli O26:H11 str. 2010C-3871 tRNA-Leu
    2287. Escherichia coli O26:H11 str. 2010C-3902 tRNA-Leu
    2288. Escherichia coli O26:H11 str. 2010C-4244 tRNA-Leu
    2289. Escherichia coli O26:H11 str. 2010C-4430 tRNA-Leu
    2290. Escherichia coli O26:H11 str. 2010C-4819 tRNA-Leu
    2291. Escherichia coli O26:H11 str. 2010C-4834 tRNA-Leu
    2292. Escherichia coli O26:H11 str. 2010C-5028 tRNA-Leu
    2293. Escherichia coli O26:H11 str. 2010EL-1699 tRNA-Leu
    2294. Escherichia coli O26:H11 str. 2011C-3270 tRNA-Leu
    2295. Escherichia coli O26:H11 str. 2011C-3274 tRNA-Leu
    2296. Escherichia coli O26:H11 str. 2011C-3282 tRNA-Leu
    2297. Escherichia coli O26:H11 str. 2011C-3387 tRNA-Leu
    2298. Escherichia coli O26:H11 str. 2011C-3506 tRNA-Leu
    2299. Escherichia coli O26:H11 str. 2011C-3655 tRNA-Leu
    2300. Escherichia coli O26:H11 str. CFSAN001629 tRNA-Leu
    2301. Escherichia coli O26:H11 str. CVM10021 tRNA-Leu
    2302. Escherichia coli O26:H11 str. CVM10026 tRNA-Leu
    2303. Escherichia coli O26:H11 str. CVM10030 tRNA-Leu
    2304. Escherichia coli O26:H11 str. CVM10224 tRNA-Leu
    2305. Escherichia coli O26:H11 str. CVM9942 tRNA-Leu
    2306. Escherichia coli O26:H11 str. CVM9952 tRNA-Leu
    2307. Escherichia coli O26:H11 tRNA-Leu
    2308. Escherichia coli O26:H1 str. 2009C-4747 tRNA-Leu
    2309. Escherichia coli O26:NM str. 2010C-4347 tRNA-Leu
    2310. Escherichia coli O26:NM str. 2010C-4788 tRNA-Leu
    2311. Escherichia coli O26 str. RM10386 tRNA-Leu
    2312. Escherichia coli O26 str. RM8426 tRNA-Leu
    2313. Escherichia coli O26 tRNA-Leu
    2314. Escherichia coli O2:H1 tRNA-Leu
    2315. Escherichia coli O2:H32 tRNA-Leu
    2316. Escherichia coli O2:H6 tRNA-Leu
    2317. Escherichia coli O2 tRNA-Leu
    2318. Escherichia coli O32:H37 str. P4 tRNA-Leu
    2319. Escherichia coli O32 tRNA-Leu
    2320. Escherichia coli O33 tRNA-Leu
    2321. Escherichia coli O35 tRNA-Leu
    2322. Escherichia coli O36:H5 tRNA-Leu
    2323. Escherichia coli O36 tRNA-Leu
    2324. Escherichia coli O38:H26 tRNA-Leu
    2325. Escherichia coli O39:H21 tRNA-Leu
    2326. Escherichia coli O39:H4 tRNA-Leu
    2327. Escherichia coli O3 tRNA-Leu
    2328. Escherichia coli O40:H32 tRNA-Leu
    2329. Escherichia coli O43:H14 tRNA-Leu
    2330. Escherichia coli O43:H2 tRNA-Leu
    2331. Escherichia coli O43 str. RM10042 tRNA-Leu
    2332. Escherichia coli O45:H2 str. 01-3147 tRNA-Leu
    2333. Escherichia coli O45:H2 str. 2009C-3686 tRNA-Leu
    2334. Escherichia coli O45:H2 str. 2009C-4780 tRNA-Leu
    2335. Escherichia coli O45:H2 str. 2010C-3876 tRNA-Leu
    2336. Escherichia coli O45:H2 str. 2010C-4211 tRNA-Leu
    2337. Escherichia coli O45:H2 tRNA-Leu
    2338. Escherichia coli O49:H9 tRNA-Leu
    2339. Escherichia coli O53 tRNA-Leu
    2340. Escherichia coli O55:H7 str. 3256-97 tRNA-Leu
    2341. Escherichia coli O55:H7 str. CB9615 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2342. Escherichia coli O55:H7 str. RM12579 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2343. Escherichia coli O55:H7 str. TB182A tRNA-Leu
    2344. Escherichia coli O55:H7 str. USDA 5905 tRNA-Leu
    2345. Escherichia coli O55:H7 tRNA-Leu
    2346. Escherichia coli O55 tRNA-Leu
    2347. Escherichia coli O5:K4(L):H4 str. ATCC 23502 tRNA-Leu-TAG
    2348. Escherichia coli O5 tRNA-Leu
    2349. Escherichia coli O68:H12 tRNA-Leu
    2350. Escherichia coli O69:H11 str. 06-3325 tRNA-Leu
    2351. Escherichia coli O69:H11 str. 07-3763 tRNA-Leu
    2352. Escherichia coli O69:H11 str. 07-4281 tRNA-Leu
    2353. Escherichia coli O69:H11 str. 08-4661 tRNA-Leu
    2354. Escherichia coli O69:H11 str. 2009C-3601 tRNA-Leu
    2355. Escherichia coli O6:H16:CFA/II str. B2C tRNA-Leu
    2356. Escherichia coli O6:H16 str. 99-3165 tRNA-Leu
    2357. Escherichia coli O6:H16 str. F5656C1 tRNA-Leu
    2358. Escherichia coli O6:H34 tRNA-Leu
    2359. Escherichia coli O6 tRNA-Leu
    2360. Escherichia coli O70:H25 tRNA-Leu
    2361. Escherichia coli O73 tRNA-Leu
    2362. Escherichia coli O74:H8 tRNA-Leu
    2363. Escherichia coli O74 tRNA-Leu
    2364. Escherichia coli O78:H12 str. 00-3279 tRNA-Leu
    2365. Escherichia coli O78:H42 tRNA-Leu
    2366. Escherichia coli O78 tRNA-Leu
    2367. Escherichia coli O79:H7 str. 06-3501 tRNA-Leu
    2368. Escherichia coli O7:H4 tRNA-Leu
    2369. Escherichia coli O7:H7 tRNA-Leu
    2370. Escherichia coli O7:K1 str. CE10 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2371. Escherichia coli O80:H26 tRNA-Leu
    2372. Escherichia coli O80:H45 tRNA-Leu
    2373. Escherichia coli O81:NM str. 02-3012 tRNA-Leu
    2374. Escherichia coli O83:H1 str. NRG 857C tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2375. Escherichia coli O83:H31 tRNA-Leu
    2376. Escherichia coli O83 tRNA-Leu
    2377. Escherichia coli O84:H7 tRNA-Leu
    2378. Escherichia coli O85:H1 tRNA-Leu
    2379. Escherichia coli O86:H34 str. 99-3124 tRNA-Leu
    2380. Escherichia coli O86:H8 tRNA-Leu
    2381. Escherichia coli O88:H1 tRNA-Leu
    2382. Escherichia coli O88:H4 tRNA-Leu
    2383. Escherichia coli O89m:H10 tRNA-Leu
    2384. Escherichia coli O89m:H9 tRNA-Leu
    2385. Escherichia coli O8:H19 tRNA-Leu
    2386. Escherichia coli O8:H28 tRNA-Leu
    2387. Escherichia coli O8:H31 tRNA-Leu
    2388. Escherichia coli O8:H36 tRNA-Leu
    2389. Escherichia coli O8:H49 tRNA-Leu
    2390. Escherichia coli O8:H8 tRNA-Leu
    2391. Escherichia coli O8:H9 tRNA-Leu
    2392. Escherichia coli O8 tRNA-Leu
    2393. Escherichia coli O91:H14 str. 06-3691 tRNA-Leu
    2394. Escherichia coli O91:H14 str. 2009C-3227 tRNA-Leu
    2395. Escherichia coli O91:H21 str. 2009C-3740 tRNA-Leu
    2396. Escherichia coli O91:H21 str. 2009C-4646 tRNA-Leu
    2397. Escherichia coli O91:H21 tRNA-Leu
    2398. Escherichia coli O91:H28 tRNA-Leu
    2399. Escherichia coli O91:NM str. 2009C-3745 tRNA-Leu
    2400. Escherichia coli O91 str. RM7190 tRNA-Leu
    2401. Escherichia coli O91 tRNA-Leu
    2402. Escherichia coli O96 tRNA-Leu
    2403. Escherichia coli O99:H27 tRNA-Leu
    2404. Escherichia coli O9:H10 tRNA-Leu
    2405. Escherichia coli OK1180 tRNA-Leu
    2406. Escherichia coli OK1357 tRNA-Leu
    2407. Escherichia coli ONT:H33 str. C48/93 tRNA-Leu
    2408. Escherichia coli OP50 tRNA-Leu
    2409. Escherichia coli OX01:H8 tRNA-Leu
    2410. Escherichia coli OX38:H47 tRNA-Leu
    2411. Escherichia coli P0298942.10 tRNA-Leu
    2412. Escherichia coli P0298942.11 tRNA-Leu
    2413. Escherichia coli P0298942.12 tRNA-Leu
    2414. Escherichia coli P0298942.14 tRNA-Leu
    2415. Escherichia coli P0298942.15 tRNA-Leu
    2416. Escherichia coli P0298942.1 tRNA-Leu
    2417. Escherichia coli P0298942.2 tRNA-Leu
    2418. Escherichia coli P0298942.3 tRNA-Leu
    2419. Escherichia coli P0298942.4 tRNA-Leu
    2420. Escherichia coli P0298942.6 tRNA-Leu
    2421. Escherichia coli P0298942.7 tRNA-Leu
    2422. Escherichia coli P0298942.8 tRNA-Leu
    2423. Escherichia coli P0298942.9 tRNA-Leu
    2424. Escherichia coli P0299438.10 tRNA-Leu
    2425. Escherichia coli P0299438.11 tRNA-Leu
    2426. Escherichia coli P0299438.2 tRNA-Leu
    2427. Escherichia coli P0299438.3 tRNA-Leu
    2428. Escherichia coli P0299438.4 tRNA-Leu
    2429. Escherichia coli P0299438.5 tRNA-Leu
    2430. Escherichia coli P0299438.6 tRNA-Leu
    2431. Escherichia coli P0299438.7 tRNA-Leu
    2432. Escherichia coli P0299438.8 tRNA-Leu
    2433. Escherichia coli P0299438.9 tRNA-Leu
    2434. Escherichia coli P0299483.1 tRNA-Leu
    2435. Escherichia coli P0299483.2 tRNA-Leu
    2436. Escherichia coli P0299483.3 tRNA-Leu
    2437. Escherichia coli P02997067.6 tRNA-Leu
    2438. Escherichia coli P0299917.10 tRNA-Leu
    2439. Escherichia coli P0299917.1 tRNA-Leu
    2440. Escherichia coli P0299917.2 tRNA-Leu
    2441. Escherichia coli P0299917.3 tRNA-Leu
    2442. Escherichia coli P0299917.4 tRNA-Leu
    2443. Escherichia coli P0299917.5 tRNA-Leu
    2444. Escherichia coli P0299917.6 tRNA-Leu
    2445. Escherichia coli P0299917.7 tRNA-Leu
    2446. Escherichia coli P0299917.8 tRNA-Leu
    2447. Escherichia coli P0299917.9 tRNA-Leu
    2448. Escherichia coli P0301867.11 tRNA-Leu
    2449. Escherichia coli P0301867.13 tRNA-Leu
    2450. Escherichia coli P0301867.1 tRNA-Leu
    2451. Escherichia coli P0301867.2 tRNA-Leu
    2452. Escherichia coli P0301867.3 tRNA-Leu
    2453. Escherichia coli P0301867.4 tRNA-Leu
    2454. Escherichia coli P0301867.5 tRNA-Leu
    2455. Escherichia coli P0301867.7 tRNA-Leu
    2456. Escherichia coli P0301867.8 tRNA-Leu
    2457. Escherichia coli P0301904.3 tRNA-Leu
    2458. Escherichia coli P0302293.10 tRNA-Leu
    2459. Escherichia coli P0302293.2 tRNA-Leu
    2460. Escherichia coli P0302293.3 tRNA-Leu
    2461. Escherichia coli P0302293.4 tRNA-Leu
    2462. Escherichia coli P0302293.6 tRNA-Leu
    2463. Escherichia coli P0302293.7 tRNA-Leu
    2464. Escherichia coli P0302293.8 tRNA-Leu
    2465. Escherichia coli P0302293.9 tRNA-Leu
    2466. Escherichia coli P0302308.10 tRNA-Leu
    2467. Escherichia coli P0302308.11 tRNA-Leu
    2468. Escherichia coli P0302308.12 tRNA-Leu
    2469. Escherichia coli P0302308.13 tRNA-Leu
    2470. Escherichia coli P0302308.14 tRNA-Leu
    2471. Escherichia coli P0302308.1 tRNA-Leu
    2472. Escherichia coli P0302308.2 tRNA-Leu
    2473. Escherichia coli P0302308.3 tRNA-Leu
    2474. Escherichia coli P0302308.4 tRNA-Leu
    2475. Escherichia coli P0302308.5 tRNA-Leu
    2476. Escherichia coli P0304777.10 tRNA-Leu
    2477. Escherichia coli P0304777.11 tRNA-Leu
    2478. Escherichia coli P0304777.12 tRNA-Leu
    2479. Escherichia coli P0304777.13 tRNA-Leu
    2480. Escherichia coli P0304777.14 tRNA-Leu
    2481. Escherichia coli P0304777.15 tRNA-Leu
    2482. Escherichia coli P0304777.1 tRNA-Leu
    2483. Escherichia coli P0304777.2 tRNA-Leu
    2484. Escherichia coli P0304777.3 tRNA-Leu
    2485. Escherichia coli P0304777.4 tRNA-Leu
    2486. Escherichia coli P0304777.5 tRNA-Leu
    2487. Escherichia coli P0304777.7 tRNA-Leu
    2488. Escherichia coli P0304777.8 tRNA-Leu
    2489. Escherichia coli P0304777.9 tRNA-Leu
    2490. Escherichia coli P0304799.3 tRNA-Leu
    2491. Escherichia coli P0304816.10 tRNA-Leu
    2492. Escherichia coli P0304816.11 tRNA-Leu
    2493. Escherichia coli P0304816.12 tRNA-Leu
    2494. Escherichia coli P0304816.13 tRNA-Leu
    2495. Escherichia coli P0304816.14 tRNA-Leu
    2496. Escherichia coli P0304816.15 tRNA-Leu
    2497. Escherichia coli P0304816.1 tRNA-Leu
    2498. Escherichia coli P0304816.2 tRNA-Leu
    2499. Escherichia coli P0304816.3 tRNA-Leu
    2500. Escherichia coli P0304816.4 tRNA-Leu
    2501. Escherichia coli P0304816.5 tRNA-Leu
    2502. Escherichia coli P0304816.6 tRNA-Leu
    2503. Escherichia coli P0304816.7 tRNA-Leu
    2504. Escherichia coli P0304816.8 tRNA-Leu
    2505. Escherichia coli P0304816.9 tRNA-Leu
    2506. Escherichia coli P0305260.10 tRNA-Leu
    2507. Escherichia coli P0305260.11 tRNA-Leu
    2508. Escherichia coli P0305260.12 tRNA-Leu
    2509. Escherichia coli P0305260.13 tRNA-Leu
    2510. Escherichia coli P0305260.15 tRNA-Leu
    2511. Escherichia coli P0305260.1 tRNA-Leu
    2512. Escherichia coli P0305260.2 tRNA-Leu
    2513. Escherichia coli P0305260.3 tRNA-Leu
    2514. Escherichia coli P0305260.4 tRNA-Leu
    2515. Escherichia coli P0305260.5 tRNA-Leu
    2516. Escherichia coli P0305260.6 tRNA-Leu
    2517. Escherichia coli P0305260.7 tRNA-Leu
    2518. Escherichia coli P0305260.8 tRNA-Leu
    2519. Escherichia coli P0305260.9 tRNA-Leu
    2520. Escherichia coli p0305293.10 tRNA-Leu
    2521. Escherichia coli p0305293.11 tRNA-Leu
    2522. Escherichia coli p0305293.12 tRNA-Leu
    2523. Escherichia coli p0305293.13 tRNA-Leu
    2524. Escherichia coli p0305293.14 tRNA-Leu
    2525. Escherichia coli p0305293.15 tRNA-Leu
    2526. Escherichia coli p0305293.1 tRNA-Leu
    2527. Escherichia coli p0305293.2 tRNA-Leu
    2528. Escherichia coli p0305293.3 tRNA-Leu
    2529. Escherichia coli p0305293.4 tRNA-Leu
    2530. Escherichia coli p0305293.5 tRNA-Leu
    2531. Escherichia coli p0305293.6 tRNA-Leu
    2532. Escherichia coli p0305293.7 tRNA-Leu
    2533. Escherichia coli p0305293.8 tRNA-Leu
    2534. Escherichia coli p0305293.9 tRNA-Leu
    2535. Escherichia coli P12b tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2536. Escherichia coli P4-96 tRNA-Leu
    2537. Escherichia coli P4-NR tRNA-Leu
    2538. Escherichia coli PA10 tRNA-Leu
    2539. Escherichia coli PA11 tRNA-Leu
    2540. Escherichia coli PA13 tRNA-Leu
    2541. Escherichia coli PA14 tRNA-Leu
    2542. Escherichia coli PA15 tRNA-Leu
    2543. Escherichia coli PA19 tRNA-Leu
    2544. Escherichia coli PA22 tRNA-Leu
    2545. Escherichia coli PA23 tRNA-Leu
    2546. Escherichia coli PA24 tRNA-Leu
    2547. Escherichia coli PA25 tRNA-Leu
    2548. Escherichia coli PA28 tRNA-Leu
    2549. Escherichia coli PA2 tRNA-Leu
    2550. Escherichia coli PA31 tRNA-Leu
    2551. Escherichia coli PA32 tRNA-Leu
    2552. Escherichia coli PA33 tRNA-Leu
    2553. Escherichia coli PA34 tRNA-Leu
    2554. Escherichia coli PA35 tRNA-Leu
    2555. Escherichia coli PA38 tRNA-Leu
    2556. Escherichia coli PA39 tRNA-Leu
    2557. Escherichia coli PA3 tRNA-Leu
    2558. Escherichia coli PA40 tRNA-Leu
    2559. Escherichia coli PA41 tRNA-Leu
    2560. Escherichia coli PA42 tRNA-Leu
    2561. Escherichia coli PA45 tRNA-Leu
    2562. Escherichia coli PA47 tRNA-Leu
    2563. Escherichia coli PA48 tRNA-Leu
    2564. Escherichia coli PA49 tRNA-Leu
    2565. Escherichia coli PA4 tRNA-Leu
    2566. Escherichia coli PA5 tRNA-Leu
    2567. Escherichia coli PA7 tRNA-Leu
    2568. Escherichia coli PA8 tRNA-Leu
    2569. Escherichia coli PA9 tRNA-Leu
    2570. Escherichia coli PCN033 tRNA-Leu
    2571. Escherichia coli PCN061 tRNA-Leu
    2572. Escherichia coli PMV-1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2573. Escherichia coli R527 tRNA-Leu
    2574. Escherichia coli RN587/1 tRNA-Leu
    2575. Escherichia coli RS218 tRNA-Leu
    2576. Escherichia coli S88 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2577. Escherichia coli SE11 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2578. Escherichia coli SE15 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2579. Escherichia coli SHECO001 tRNA-Leu
    2580. Escherichia coli SHECO002 tRNA-Leu
    2581. Escherichia coli SHECO003 tRNA-Leu
    2582. Escherichia coli SMS-3-5 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2583. Escherichia coli STEC_7v tRNA-Leu
    2584. Escherichia coli STEC_94C tRNA-Leu
    2585. Escherichia coli O91:H21 str. B2F1 tRNA-Leu
    2586. Escherichia coli STEC_C165-02 tRNA-Leu
    2587. Escherichia coli STEC_DG131-3 tRNA-Leu
    2588. Escherichia coli STEC_EH250 tRNA-Leu
    2589. Escherichia coli STEC_MHI813 tRNA-Leu
    2590. Escherichia coli STEC_O31 tRNA-Leu
    2591. Escherichia coli STEC_S1191 tRNA-Leu
    2592. Escherichia coli str. 'clone D i14' tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2593. Escherichia coli str. 'clone D i2' tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2594. Escherichia coli str. K-12 substr. DH10B tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2595. Escherichia coli str. K-12 substr. MC4100 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2596. Escherichia coli str. K-12 substr. MDS42 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2597. Escherichia coli str. K-12 substr. MG1655 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2598. Escherichia coli str. K-12 substr. W3110 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2599. Escherichia coli str. Sanji tRNA-Leu
    2600. Escherichia coli SWW33 tRNA-Leu
    2601. Escherichia coli T1282_01 tRNA-Leu
    2602. Escherichia coli T1840_97 tRNA-Leu
    2603. Escherichia coli T234_00 tRNA-Leu
    2604. Escherichia coli T426 tRNA-Leu
    2605. Escherichia coli T924_01 tRNA-Leu
    2606. Escherichia coli TA008 tRNA-Leu
    2607. Escherichia coli TA014 tRNA-Leu
    2608. Escherichia coli TA054 tRNA-Leu
    2609. Escherichia coli TA143 tRNA-Leu
    2610. Escherichia coli TA144 tRNA-Leu
    2611. Escherichia coli TA206 tRNA-Leu
    2612. Escherichia coli TA249 tRNA-Leu
    2613. Escherichia coli TA255 tRNA-Leu
    2614. Escherichia coli TA271 tRNA-Leu
    2615. Escherichia coli TA280 tRNA-Leu
    2616. Escherichia coli TA447 tRNA-Leu
    2617. Escherichia coli TA464 tRNA-Leu
    2618. Escherichia coli ThroopD tRNA-Leu
    2619. Escherichia coli TT12B tRNA-Leu
    2620. Escherichia coli TW00353 tRNA-Leu
    2621. Escherichia coli TW06591 tRNA-Leu
    2622. Escherichia coli TW07509 tRNA-Leu
    2623. Escherichia coli TW07793 tRNA-Leu
    2624. Escherichia coli TW07945 tRNA-Leu
    2625. Escherichia coli TW09098 tRNA-Leu
    2626. Escherichia coli TW09109 tRNA-Leu
    2627. Escherichia coli TW09195 tRNA-Leu
    2628. Escherichia coli TW10119 tRNA-Leu
    2629. Escherichia coli TW10246 tRNA-Leu
    2630. Escherichia coli TW10509 tRNA-Leu
    2631. Escherichia coli TW11039 tRNA-Leu
    2632. Escherichia coli TW14301 tRNA-Leu
    2633. Escherichia coli TW15901 tRNA-Leu
    2634. Escherichia coli Tx1686 tRNA-Leu
    2635. Escherichia coli TX1999 tRNA-Leu
    2636. Escherichia coli Tx3800 tRNA-Leu
    2637. Escherichia coli UCI 51 tRNA-Leu
    2638. Escherichia coli UCI 52 tRNA-Leu
    2639. Escherichia coli UCI 53 tRNA-Leu
    2640. Escherichia coli UCI 57 tRNA-Leu
    2641. Escherichia coli UCI 58 tRNA-Leu
    2642. Escherichia coli UCI 65 tRNA-Leu
    2643. Escherichia coli UCI 66 tRNA-Leu
    2644. Escherichia coli UM146 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2645. Escherichia coli UMEA 3014-1 tRNA-Leu
    2646. Escherichia coli UMEA 3022-1 tRNA-Leu
    2647. Escherichia coli UMEA 3033-1 tRNA-Leu
    2648. Escherichia coli UMEA 3041-1 tRNA-Leu
    2649. Escherichia coli UMEA 3052-1 tRNA-Leu
    2650. Escherichia coli UMEA 3053-1 tRNA-Leu
    2651. Escherichia coli UMEA 3065-1 tRNA-Leu
    2652. Escherichia coli UMEA 3087-1 tRNA-Leu
    2653. Escherichia coli UMEA 3088-1 tRNA-Leu
    2654. Escherichia coli UMEA 3097-1 tRNA-Leu
    2655. Escherichia coli UMEA 3108-1 tRNA-Leu
    2656. Escherichia coli UMEA 3113-1 tRNA-Leu
    2657. Escherichia coli UMEA 3117-1 tRNA-Leu
    2658. Escherichia coli UMEA 3121-1 tRNA-Leu
    2659. Escherichia coli UMEA 3122-1 tRNA-Leu
    2660. Escherichia coli UMEA 3124-1 tRNA-Leu
    2661. Escherichia coli UMEA 3139-1 tRNA-Leu
    2662. Escherichia coli UMEA 3140-1 tRNA-Leu
    2663. Escherichia coli UMEA 3144-1 tRNA-Leu
    2664. Escherichia coli UMEA 3148-1 tRNA-Leu
    2665. Escherichia coli UMEA 3150-1 tRNA-Leu
    2666. Escherichia coli UMEA 3151-1 tRNA-Leu
    2667. Escherichia coli UMEA 3152-1 tRNA-Leu
    2668. Escherichia coli UMEA 3155-1 tRNA-Leu
    2669. Escherichia coli UMEA 3159-1 tRNA-Leu
    2670. Escherichia coli UMEA 3160-1 tRNA-Leu
    2671. Escherichia coli UMEA 3161-1 tRNA-Leu
    2672. Escherichia coli UMEA 3162-1 tRNA-Leu
    2673. Escherichia coli UMEA 3163-1 tRNA-Leu
    2674. Escherichia coli UMEA 3172-1 tRNA-Leu
    2675. Escherichia coli UMEA 3173-1 tRNA-Leu
    2676. Escherichia coli UMEA 3174-1 tRNA-Leu
    2677. Escherichia coli UMEA 3176-1 tRNA-Leu
    2678. Escherichia coli UMEA 3178-1 tRNA-Leu
    2679. Escherichia coli UMEA 3180-1 tRNA-Leu
    2680. Escherichia coli UMEA 3185-1 tRNA-Leu
    2681. Escherichia coli UMEA 3193-1 tRNA-Leu
    2682. Escherichia coli UMEA 3199-1 tRNA-Leu
    2683. Escherichia coli UMEA 3200-1 tRNA-Leu
    2684. Escherichia coli UMEA 3201-1 tRNA-Leu
    2685. Escherichia coli UMEA 3203-1 tRNA-Leu
    2686. Escherichia coli UMEA 3206-1 tRNA-Leu
    2687. Escherichia coli UMEA 3208-1 tRNA-Leu
    2688. Escherichia coli UMEA 3212-1 tRNA-Leu
    2689. Escherichia coli UMEA 3215-1 tRNA-Leu
    2690. Escherichia coli UMEA 3216-1 tRNA-Leu
    2691. Escherichia coli UMEA 3217-1 tRNA-Leu
    2692. Escherichia coli UMEA 3221-1 tRNA-Leu
    2693. Escherichia coli UMEA 3222-1 tRNA-Leu
    2694. Escherichia coli UMEA 3230-1 tRNA-Leu
    2695. Escherichia coli UMEA 3233-1 tRNA-Leu
    2696. Escherichia coli UMEA 3240-1 tRNA-Leu
    2697. Escherichia coli UMEA 3244-1 tRNA-Leu
    2698. Escherichia coli UMEA 3257-1 tRNA-Leu
    2699. Escherichia coli UMEA 3264-1 tRNA-Leu
    2700. Escherichia coli UMEA 3268-1 tRNA-Leu
    2701. Escherichia coli UMEA 3271-1 tRNA-Leu
    2702. Escherichia coli UMEA 3290-1 tRNA-Leu
    2703. Escherichia coli UMEA 3292-1 tRNA-Leu
    2704. Escherichia coli UMEA 3298-1 tRNA-Leu
    2705. Escherichia coli UMEA 3304-1 tRNA-Leu
    2706. Escherichia coli UMEA 3314-1 tRNA-Leu
    2707. Escherichia coli UMEA 3317-1 tRNA-Leu
    2708. Escherichia coli UMEA 3318-1 tRNA-Leu
    2709. Escherichia coli UMEA 3323-1 tRNA-Leu
    2710. Escherichia coli UMEA 3329-1 tRNA-Leu
    2711. Escherichia coli UMEA 3336-1 tRNA-Leu
    2712. Escherichia coli UMEA 3337-1 tRNA-Leu
    2713. Escherichia coli UMEA 3341-1 tRNA-Leu
    2714. Escherichia coli UMEA 3342-1 tRNA-Leu
    2715. Escherichia coli UMEA 3355-1 tRNA-Leu
    2716. Escherichia coli UMEA 3391-1 tRNA-Leu
    2717. Escherichia coli UMEA 3426-1 tRNA-Leu
    2718. Escherichia coli UMEA 3489-1 tRNA-Leu
    2719. Escherichia coli UMEA 3490-1 tRNA-Leu
    2720. Escherichia coli UMEA 3585-1 tRNA-Leu
    2721. Escherichia coli UMEA 3592-1 tRNA-Leu
    2722. Escherichia coli UMEA 3609-1 tRNA-Leu
    2723. Escherichia coli UMEA 3617-1 tRNA-Leu
    2724. Escherichia coli UMEA 3632-1 tRNA-Leu
    2725. Escherichia coli UMEA 3652-1 tRNA-Leu
    2726. Escherichia coli UMEA 3656-1 tRNA-Leu
    2727. Escherichia coli UMEA 3671-1 tRNA-Leu
    2728. Escherichia coli UMEA 3682-1 tRNA-Leu
    2729. Escherichia coli UMEA 3687-1 tRNA-Leu
    2730. Escherichia coli UMEA 3693-1 tRNA-Leu
    2731. Escherichia coli UMEA 3694-1 tRNA-Leu
    2732. Escherichia coli UMEA 3702-1 tRNA-Leu
    2733. Escherichia coli UMEA 3703-1 tRNA-Leu
    2734. Escherichia coli UMEA 3705-1 tRNA-Leu
    2735. Escherichia coli UMEA 3707-1 tRNA-Leu
    2736. Escherichia coli UMEA 3718-1 tRNA-Leu
    2737. Escherichia coli UMEA 3805-1 tRNA-Leu
    2738. Escherichia coli UMEA 3821-1 tRNA-Leu
    2739. Escherichia coli UMEA 3834-1 tRNA-Leu
    2740. Escherichia coli UMEA 3889-1 tRNA-Leu
    2741. Escherichia coli UMEA 3893-1 tRNA-Leu
    2742. Escherichia coli UMEA 3899-1 tRNA-Leu
    2743. Escherichia coli UMEA 3955-1 tRNA-Leu
    2744. Escherichia coli UMEA 4075-1 tRNA-Leu
    2745. Escherichia coli UMEA 4076-1 tRNA-Leu
    2746. Escherichia coli UMEA 4207-1 tRNA-Leu
    2747. Escherichia coli UMN026 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2748. Escherichia coli UMNF18 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2749. Escherichia coli UMNK88 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2750. Escherichia coli UTI89 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2751. Escherichia coli VL2732 tRNA-Leu
    2752. Escherichia coli VL2874 tRNA-Leu
    2753. Escherichia coli VR50 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2754. Escherichia coli W26 tRNA-Leu
    2755. Escherichia coli W tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2756. Escherichia coli XH001 tRNA-Leu
    2757. Escherichia coli XH140A tRNA-Leu
    2758. Escherichia coli Xuzhou21 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2759. Escherichia fergusonii ATCC 35469 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2760. Escherichia fergusonii B253 tRNA-Leu
    2761. Escherichia fergusonii tRNA-Leu(tag)
    2762. Escherichia marmotae tRNA-Leu(tag)
    2763. Escherichia ruysiae tRNA-Leu
    2764. Escherichia sp. 0.2392 tRNA-Leu
    2765. Escherichia sp. 11.1596 tRNA-Leu
    2766. Escherichia sp. 11.1597 tRNA-Leu
    2767. Escherichia sp. 11.1600 tRNA-Leu
    2768. Escherichia sp. 1_1_43 tRNA-Leu
    2769. Escherichia sp. 12.2610 tRNA-Leu
    2770. Escherichia sp. 12.2612 tRNA-Leu
    2771. Escherichia sp. 14.0982 tRNA-Leu
    2772. Escherichia sp. 14.0985 tRNA-Leu
    2773. Escherichia sp. 14.0993 tRNA-Leu
    2774. Escherichia sp. 20412-1 tRNA-Leu
    2775. Escherichia sp. 4_1_40B tRNA-Leu
    2776. Escherichia sp. 4726-5 tRNA-Leu
    2777. Escherichia sp. 79.0191 tRNA-Leu
    2778. Escherichia sp. 8.2195 tRNA-Leu
    2779. Escherichia sp. 92.1228 tRNA-Leu
    2780. Escherichia sp. 93.0724 tRNA-Leu
    2781. Escherichia sp. 93.0743 tRNA-Leu
    2782. Escherichia sp. 93.0750 tRNA-Leu
    2783. Escherichia sp. 93.0816 tRNA-Leu
    2784. Escherichia sp. 93.1447 tRNA-Leu
    2785. Escherichia sp. 93.1462 tRNA-Leu
    2786. Escherichia sp. 93.1518 tRNA-Leu
    2787. Escherichia sp. 94.0001 tRNA-Leu
    2788. Escherichia sp. E10V10 tRNA-Leu
    2789. Escherichia sp. E10V4 tRNA-Leu
    2790. Escherichia sp. E10V5 tRNA-Leu
    2791. Escherichia sp. E1130 tRNA-Leu
    2792. Escherichia sp. E13S3 tRNA-Leu
    2793. Escherichia sp. E14S1 tRNA-Leu
    2794. Escherichia sp. E14V10 tRNA-Leu
    2795. Escherichia sp. E14V5 tRNA-Leu
    2796. Escherichia sp. E14V7 tRNA-Leu
    2797. Escherichia sp. E1S7 tRNA-Leu
    2798. Escherichia sp. E1V33 tRNA-Leu
    2799. Escherichia sp. E2562 tRNA-Leu
    2800. Escherichia sp. E2586 tRNA-Leu
    2801. Escherichia sp. E2593 tRNA-Leu
    2802. Escherichia sp. E2661 tRNA-Leu
    2803. Escherichia sp. E2748 tRNA-Leu
    2804. Escherichia sp. E3356 tRNA-Leu
    2805. Escherichia sp. E3659 tRNA-Leu
    2806. Escherichia sp. E4208 tRNA-Leu
    2807. Escherichia sp. E4385 tRNA-Leu
    2808. Escherichia sp. E4694 tRNA-Leu
    2809. Escherichia sp. E4702 tRNA-Leu
    2810. Escherichia sp. E4736 tRNA-Leu
    2811. Escherichia sp. E4742 tRNA-Leu
    2812. Escherichia sp. E4930 tRNA-Leu
    2813. Escherichia sp. E5028 tRNA-Leu
    2814. Escherichia sp. ESNIH1 tRNA-Leu
    2815. Escherichia sp. HH26CH tRNA-Leu
    2816. Escherichia sp. HH41S tRNA-Leu
    2817. Escherichia sp. JL983 tRNA-Leu
    2818. Escherichia sp. KCJ4928 tRNA-Leu
    2819. Escherichia sp. KCJ4943 tRNA-Leu
    2820. Escherichia sp. KTE114 tRNA-Leu
    2821. Escherichia sp. KTE11 tRNA-Leu
    2822. Escherichia sp. KTE159 tRNA-Leu
    2823. Escherichia sp. KTE172 tRNA-Leu
    2824. Escherichia sp. KTE31 tRNA-Leu
    2825. Escherichia sp. KTE52 tRNA-Leu
    2826. Escherichia sp. KTE96 tRNA-Leu
    2827. Escherichia sp. L7 tRNA-Leu
    2828. Escherichia sp. MOD1-EC5451 tRNA-Leu
    2829. Escherichia sp. MOD1-EC6475 tRNA-Leu
    2830. Escherichia sp. MR tRNA-Leu
    2831. Escherichia sp. NIC32-2 tRNA-Leu
    2832. Escherichia sp. NT45 tRNA-Leu
    2833. Escherichia sp. R8 tRNA-Leu
    2834. Escherichia sp. S69_ASV_4 tRNA-Leu
    2835. Escherichia sp. S85_ASV_4 tRNA-Leu
    2836. Escherichia whittamii tRNA-Leu
    2837. Escherichia sp. SCLE84 tRNA-Leu
    2838. Escherichia sp. TC-EC600-tetX4 tRNA-Leu
    2839. Escherichia sp. TM-G17TGC tRNA-Leu
    2840. Franconibacter daqui tRNA-Leu
    2841. Franconibacter pulveris tRNA-Leu
    2842. Gibbsiella quercinecans tRNA-Leu
    2843. Izhakiella australiensis tRNA-Leu
    2844. Jejubacter calystegiae tRNA-Leu
    2845. Klebsiella aerogenes EA1509E tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2846. Klebsiella aerogenes KCTC 2190 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2847. Klebsiella aerogenes MGH 61 tRNA-Leu
    2848. Klebsiella aerogenes MGH 62 tRNA-Leu
    2849. Klebsiella aerogenes MGH 77 tRNA-Leu
    2850. Klebsiella aerogenes MGH 78 tRNA-Leu
    2851. Klebsiella aerogenes tRNA-Leu(tag)
    2852. Klebsiella aerogenes UCI 15 tRNA-Leu
    2853. Klebsiella aerogenes UCI 16 tRNA-Leu
    2854. Klebsiella aerogenes UCI 27 tRNA-Leu
    2855. Klebsiella aerogenes UCI 28 tRNA-Leu
    2856. Klebsiella aerogenes UCI 45 tRNA-Leu
    2857. Klebsiella aerogenes UCI 46 tRNA-Leu
    2858. Klebsiella aerogenes UCI 47 tRNA-Leu
    2859. Klebsiella aerogenes UCI 48 tRNA-Leu
    2860. Klebsiella africana tRNA-Leu
    2861. Klebsiella grimontii tRNA-Leu(tag)
    2862. Klebsiella michiganensis E718 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2863. Klebsiella michiganensis HKOPL1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2864. Klebsiella michiganensis KCTC 1686 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2865. Klebsiella michiganensis M5al tRNA-Leu
    2866. Klebsiella michiganensis tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2867. Klebsiella oxytoca 09-7231 tRNA-Leu
    2868. Klebsiella oxytoca 10-5243 tRNA-Leu
    2869. Klebsiella oxytoca 10-5244 tRNA-Leu
    2870. Klebsiella oxytoca 10-5245 tRNA-Leu
    2871. Klebsiella oxytoca 10-5248 tRNA-Leu
    2872. Klebsiella oxytoca 10-5249 tRNA-Leu
    2873. Klebsiella oxytoca G54 tRNA-Leu
    2874. Klebsiella oxytoca tRNA-Leu
    2875. Klebsiella oxytoca KA-2 tRNA-Leu
    2876. Klebsiella oxytoca KONIH1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2877. Klebsiella oxytoca MGH 27 tRNA-Leu
    2878. Klebsiella oxytoca MGH 28 tRNA-Leu
    2879. Klebsiella oxytoca MGH 41 tRNA-Leu
    2880. Klebsiella oxytoca MGH 42 tRNA-Leu
    2881. Klebsiella oxytoca OK-1 tRNA-Leu
    2882. Klebsiella pasteurii tRNA-Leu(tag)
    2883. Klebsiella pneumoniae 120_1020 tRNA-Leu
    2884. Klebsiella pneumoniae 140_1040 tRNA-Leu
    2885. Klebsiella pneumoniae 160_1080 tRNA-Leu
    2886. Klebsiella pneumoniae 280_1220 tRNA-Leu
    2887. Klebsiella pneumoniae 303K tRNA-Leu
    2888. Klebsiella pneumoniae 30660/NJST258_1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2889. Klebsiella pneumoniae 30684/NJST258_2 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2890. Klebsiella pneumoniae 361_1301 tRNA-Leu
    2891. Klebsiella pneumoniae 500_1420 tRNA-Leu
    2892. Klebsiella pneumoniae 540_1460 tRNA-Leu
    2893. Klebsiella pneumoniae 646_1568 tRNA-Leu
    2894. Klebsiella pneumoniae 909957 tRNA-Leu
    2895. Klebsiella pneumoniae ATCC BAA-1705 tRNA-Leu
    2896. Klebsiella pneumoniae ATCC BAA-2146 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2897. Klebsiella pneumoniae BIDMC 10 tRNA-Leu
    2898. Klebsiella pneumoniae BIDMC 11 tRNA-Leu
    2899. Klebsiella pneumoniae BIDMC 12A tRNA-Leu
    2900. Klebsiella pneumoniae BIDMC 12B tRNA-Leu
    2901. Klebsiella pneumoniae BIDMC 12C tRNA-Leu
    2902. Klebsiella pneumoniae BIDMC 13 tRNA-Leu
    2903. Klebsiella pneumoniae BIDMC 14 tRNA-Leu
    2904. Klebsiella pneumoniae BIDMC 16 tRNA-Leu
    2905. Klebsiella pneumoniae BIDMC 18A tRNA-Leu
    2906. Klebsiella pneumoniae BIDMC 18B tRNA-Leu
    2907. Klebsiella pneumoniae BIDMC 18C tRNA-Leu
    2908. Klebsiella pneumoniae BIDMC 18D tRNA-Leu
    2909. Klebsiella pneumoniae BIDMC 1 tRNA-Leu
    2910. Klebsiella pneumoniae BIDMC 21 tRNA-Leu
    2911. Klebsiella pneumoniae BIDMC 22 tRNA-Leu
    2912. Klebsiella pneumoniae BIDMC 23 tRNA-Leu
    2913. Klebsiella pneumoniae BIDMC 24 tRNA-Leu
    2914. Klebsiella pneumoniae BIDMC 25 tRNA-Leu
    2915. Klebsiella pneumoniae BIDMC 2A tRNA-Leu
    2916. Klebsiella pneumoniae BIDMC 31 tRNA-Leu
    2917. Klebsiella pneumoniae BIDMC 32 tRNA-Leu
    2918. Klebsiella pneumoniae BIDMC 33B tRNA-Leu
    2919. Klebsiella pneumoniae BIDMC 34 tRNA-Leu
    2920. Klebsiella pneumoniae BIDMC 35 tRNA-Leu
    2921. Klebsiella pneumoniae BIDMC 36 tRNA-Leu
    2922. Klebsiella pneumoniae BIDMC 40 tRNA-Leu
    2923. Klebsiella pneumoniae BIDMC 41 tRNA-Leu
    2924. Klebsiella pneumoniae BIDMC 42a tRNA-Leu
    2925. Klebsiella pneumoniae BIDMC 42b tRNA-Leu
    2926. Klebsiella pneumoniae BIDMC 45 tRNA-Leu
    2927. Klebsiella pneumoniae BIDMC 46a tRNA-Leu
    2928. Klebsiella pneumoniae BIDMC 46b tRNA-Leu
    2929. Klebsiella pneumoniae BIDMC 47 tRNA-Leu
    2930. Klebsiella pneumoniae BIDMC 48 tRNA-Leu
    2931. Klebsiella pneumoniae BIDMC 4 tRNA-Leu
    2932. Klebsiella pneumoniae BIDMC 51 tRNA-Leu
    2933. Klebsiella pneumoniae BIDMC 52 tRNA-Leu
    2934. Klebsiella pneumoniae BIDMC 53 tRNA-Leu
    2935. Klebsiella pneumoniae BIDMC 54 tRNA-Leu
    2936. Klebsiella pneumoniae BIDMC 55 tRNA-Leu
    2937. Klebsiella pneumoniae BIDMC 5 tRNA-Leu
    2938. Klebsiella pneumoniae BIDMC 60 tRNA-Leu
    2939. Klebsiella pneumoniae BIDMC 68 tRNA-Leu
    2940. Klebsiella pneumoniae BIDMC 69 tRNA-Leu
    2941. Klebsiella pneumoniae BIDMC 7A tRNA-Leu
    2942. Klebsiella pneumoniae BIDMC 7B tRNA-Leu
    2943. Klebsiella pneumoniae BWH 15 tRNA-Leu
    2944. Klebsiella pneumoniae BWH 22 tRNA-Leu
    2945. Klebsiella pneumoniae BWH 28 tRNA-Leu
    2946. Klebsiella pneumoniae BWH 2 tRNA-Leu
    2947. Klebsiella pneumoniae BWH 30 tRNA-Leu
    2948. Klebsiella pneumoniae BWH 36 tRNA-Leu
    2949. Klebsiella pneumoniae BWH 41 tRNA-Leu
    2950. Klebsiella pneumoniae BWH 45 tRNA-Leu
    2951. Klebsiella pneumoniae BWH 46 tRNA-Leu
    2952. Klebsiella pneumoniae BWH 47 tRNA-Leu
    2953. Klebsiella pneumoniae BWH 48 tRNA-Leu
    2954. Klebsiella pneumoniae CG43 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    2955. Klebsiella pneumoniae CHS 02 tRNA-Leu
    2956. Klebsiella pneumoniae CHS 03 tRNA-Leu
    2957. Klebsiella pneumoniae CHS 05 tRNA-Leu
    2958. Klebsiella pneumoniae CHS 06 tRNA-Leu
    2959. Klebsiella pneumoniae CHS 07 tRNA-Leu
    2960. Klebsiella pneumoniae CHS 08 tRNA-Leu
    2961. Klebsiella pneumoniae CHS 09 tRNA-Leu
    2962. Klebsiella pneumoniae CHS 11 tRNA-Leu
    2963. Klebsiella pneumoniae CHS 12 tRNA-Leu
    2964. Klebsiella pneumoniae CHS 13 tRNA-Leu
    2965. Klebsiella pneumoniae CHS 14 tRNA-Leu
    2966. Klebsiella pneumoniae CHS 16 tRNA-Leu
    2967. Klebsiella pneumoniae CHS 17 tRNA-Leu
    2968. Klebsiella pneumoniae CHS 18 tRNA-Leu
    2969. Klebsiella pneumoniae CHS 19 tRNA-Leu
    2970. Klebsiella pneumoniae CHS 20 tRNA-Leu
    2971. Klebsiella pneumoniae CHS 21 tRNA-Leu
    2972. Klebsiella pneumoniae CHS 22 tRNA-Leu
    2973. Klebsiella pneumoniae CHS 23 tRNA-Leu
    2974. Klebsiella pneumoniae CHS 24 tRNA-Leu
    2975. Klebsiella pneumoniae CHS 25 tRNA-Leu
    2976. Klebsiella pneumoniae CHS 26 tRNA-Leu
    2977. Klebsiella pneumoniae CHS 27 tRNA-Leu
    2978. Klebsiella pneumoniae CHS 28 tRNA-Leu
    2979. Klebsiella pneumoniae CHS 29 tRNA-Leu
    2980. Klebsiella pneumoniae CHS 30 tRNA-Leu
    2981. Klebsiella pneumoniae CHS 31 tRNA-Leu
    2982. Klebsiella pneumoniae CHS 32 tRNA-Leu
    2983. Klebsiella pneumoniae CHS 33 tRNA-Leu
    2984. Klebsiella pneumoniae CHS 34 tRNA-Leu
    2985. Klebsiella pneumoniae CHS 35 tRNA-Leu
    2986. Klebsiella pneumoniae CHS 36 tRNA-Leu
    2987. Klebsiella pneumoniae CHS 37 tRNA-Leu
    2988. Klebsiella pneumoniae CHS 38 tRNA-Leu
    2989. Klebsiella pneumoniae CHS 39 tRNA-Leu
    2990. Klebsiella pneumoniae CHS 40 tRNA-Leu
    2991. Klebsiella pneumoniae CHS 41 tRNA-Leu
    2992. Klebsiella pneumoniae CHS 42 tRNA-Leu
    2993. Klebsiella pneumoniae CHS 43 tRNA-Leu
    2994. Klebsiella pneumoniae CHS 44 tRNA-Leu
    2995. Klebsiella pneumoniae CHS 45 tRNA-Leu
    2996. Klebsiella pneumoniae CHS 46 tRNA-Leu
    2997. Klebsiella pneumoniae CHS 47 tRNA-Leu
    2998. Klebsiella pneumoniae CHS 48 tRNA-Leu
    2999. Klebsiella pneumoniae CHS 49 tRNA-Leu
    3000. Klebsiella pneumoniae CHS 50 tRNA-Leu
    3001. Klebsiella pneumoniae CHS 51 tRNA-Leu
    3002. Klebsiella pneumoniae CHS 52 tRNA-Leu
    3003. Klebsiella pneumoniae CHS 53 tRNA-Leu
    3004. Klebsiella pneumoniae CHS 54 tRNA-Leu
    3005. Klebsiella pneumoniae CHS 55 tRNA-Leu
    3006. Klebsiella pneumoniae CHS 56 tRNA-Leu
    3007. Klebsiella pneumoniae CHS 57 tRNA-Leu
    3008. Klebsiella pneumoniae CHS 58 tRNA-Leu
    3009. Klebsiella pneumoniae CHS 59 tRNA-Leu
    3010. Klebsiella pneumoniae CHS 60 tRNA-Leu
    3011. Klebsiella pneumoniae CHS 61 tRNA-Leu
    3012. Klebsiella pneumoniae CHS 62 tRNA-Leu
    3013. Klebsiella pneumoniae CHS 63 tRNA-Leu
    3014. Klebsiella pneumoniae CHS 64 tRNA-Leu
    3015. Klebsiella pneumoniae CHS 65 tRNA-Leu
    3016. Klebsiella pneumoniae CHS 66 tRNA-Leu
    3017. Klebsiella pneumoniae CHS 67 tRNA-Leu
    3018. Klebsiella pneumoniae CHS 70 tRNA-Leu
    3019. Klebsiella pneumoniae CHS 71 tRNA-Leu
    3020. Klebsiella pneumoniae CHS 72 tRNA-Leu
    3021. Klebsiella pneumoniae CHS 73 tRNA-Leu
    3022. Klebsiella pneumoniae CHS 74 tRNA-Leu
    3023. Klebsiella pneumoniae CHS 75 tRNA-Leu
    3024. Klebsiella pneumoniae CHS 76 tRNA-Leu
    3025. Klebsiella pneumoniae CHS 80 tRNA-Leu
    3026. Klebsiella pneumoniae DMC0526 tRNA-Leu
    3027. Klebsiella pneumoniae DMC0799 tRNA-Leu
    3028. Klebsiella pneumoniae DMC1097 tRNA-Leu
    3029. Klebsiella pneumoniae DMC1316 tRNA-Leu
    3030. Klebsiella pneumoniae EGD-HP19-C tRNA-Leu
    3031. Klebsiella pneumoniae HE12 tRNA-Leu
    3032. Klebsiella pneumoniae HK787 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3033. Klebsiella pneumoniae hvKP1 tRNA-Leu
    3034. Klebsiella pneumoniae JHCK1 tRNA-Leu
    3035. Klebsiella pneumoniae Kb140 tRNA-Leu
    3036. Klebsiella pneumoniae Kb677 tRNA-Leu
    3037. Klebsiella pneumoniae KCTC 2242 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3038. Klebsiella pneumoniae KP-11 tRNA-Leu
    3039. Klebsiella pneumoniae KP-1 tRNA-Leu
    3040. Klebsiella pneumoniae KP-7 tRNA-Leu
    3041. Klebsiella pneumoniae MGH 17 tRNA-Leu
    3042. Klebsiella pneumoniae MGH 18 tRNA-Leu
    3043. Klebsiella pneumoniae MGH 19 tRNA-Leu
    3044. Klebsiella pneumoniae MGH 21 tRNA-Leu
    3045. Klebsiella pneumoniae MGH 29 tRNA-Leu
    3046. Klebsiella pneumoniae MGH 30 tRNA-Leu
    3047. Klebsiella pneumoniae MGH 31 tRNA-Leu
    3048. Klebsiella pneumoniae MGH 32 tRNA-Leu
    3049. Klebsiella pneumoniae MGH 35 tRNA-Leu
    3050. Klebsiella pneumoniae MGH 36 tRNA-Leu
    3051. Klebsiella pneumoniae MGH 39 tRNA-Leu
    3052. Klebsiella pneumoniae MGH 43 tRNA-Leu
    3053. Klebsiella pneumoniae MGH 45 tRNA-Leu
    3054. Klebsiella pneumoniae MGH 46 tRNA-Leu
    3055. Klebsiella pneumoniae MGH 47 tRNA-Leu
    3056. Klebsiella pneumoniae MGH 48 tRNA-Leu
    3057. Klebsiella pneumoniae MGH 51 tRNA-Leu
    3058. Klebsiella pneumoniae MGH 52 tRNA-Leu
    3059. Klebsiella pneumoniae MGH 60 tRNA-Leu
    3060. Klebsiella pneumoniae MGH 63 tRNA-Leu
    3061. Klebsiella pneumoniae MGH 64 tRNA-Leu
    3062. Klebsiella pneumoniae MGH 65 tRNA-Leu
    3063. Klebsiella pneumoniae MGH 66 tRNA-Leu
    3064. Klebsiella pneumoniae MGH 67 tRNA-Leu
    3065. Klebsiella pneumoniae MGH 69 tRNA-Leu
    3066. Klebsiella pneumoniae MGH 70 tRNA-Leu
    3067. Klebsiella pneumoniae MGH 71 tRNA-Leu
    3068. Klebsiella pneumoniae MGH 72 tRNA-Leu
    3069. Klebsiella pneumoniae MGH 73 tRNA-Leu
    3070. Klebsiella pneumoniae MGH 74 tRNA-Leu
    3071. Klebsiella pneumoniae MGH 75 tRNA-Leu
    3072. Klebsiella pneumoniae MGH 79 tRNA-Leu
    3073. Klebsiella pneumoniae MRSN 1319 tRNA-Leu
    3074. Klebsiella pneumoniae MRSN 2404 tRNA-Leu
    3075. Klebsiella pneumoniae MRSN 3562 tRNA-Leu
    3076. Klebsiella pneumoniae MRSN 3852 tRNA-Leu
    3077. Klebsiella pneumoniae MRSN 6902 tRNA-Leu
    3078. Klebsiella pneumoniae RYC492 tRNA-Leu
    3079. Klebsiella pneumoniae subsp. ozaenae tRNA-Leu(tag)
    3080. Klebsiella pneumoniae subsp. pneumoniae 1084 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3081. Klebsiella pneumoniae subsp. pneumoniae 1158 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3082. Klebsiella pneumoniae subsp. pneumoniae ATCC 43816 tRNA-Leu
    3083. Klebsiella pneumoniae subsp. pneumoniae CIP 52.145 = B5055 tRNA-Leu
    3084. Klebsiella pneumoniae subsp. pneumoniae BJ1-GA tRNA-Leu
    3085. Klebsiella pneumoniae subsp. pneumoniae DSM 30104 = JCM 1662 = NBRC 14940 tRNA-Leu
    3086. Klebsiella pneumoniae subsp. pneumoniae HS11286 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3087. Klebsiella pneumoniae subsp. pneumoniae Kp13 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3088. Klebsiella pneumoniae subsp. pneumoniae KpMDU1 tRNA-Leu
    3089. Klebsiella pneumoniae subsp. pneumoniae KPNIH10 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3090. Klebsiella pneumoniae subsp. pneumoniae KPNIH11 tRNA-Leu
    3091. Klebsiella pneumoniae subsp. pneumoniae KPNIH12 tRNA-Leu
    3092. Klebsiella pneumoniae subsp. pneumoniae KPNIH14 tRNA-Leu
    3093. Klebsiella pneumoniae subsp. pneumoniae KPNIH16 tRNA-Leu
    3094. Klebsiella pneumoniae subsp. pneumoniae KPNIH17 tRNA-Leu
    3095. Klebsiella pneumoniae subsp. pneumoniae KPNIH18 tRNA-Leu
    3096. Klebsiella pneumoniae subsp. pneumoniae KPNIH19 tRNA-Leu
    3097. Klebsiella pneumoniae subsp. pneumoniae KPNIH1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3098. Klebsiella pneumoniae subsp. pneumoniae KPNIH20 tRNA-Leu
    3099. Klebsiella pneumoniae subsp. pneumoniae KPNIH21 tRNA-Leu
    3100. Klebsiella pneumoniae subsp. pneumoniae KPNIH22 tRNA-Leu
    3101. Klebsiella pneumoniae subsp. pneumoniae KPNIH23 tRNA-Leu
    3102. Klebsiella pneumoniae subsp. pneumoniae KPNIH24 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3103. Klebsiella pneumoniae subsp. pneumoniae KPNIH27 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3104. Klebsiella pneumoniae subsp. pneumoniae KPNIH2 tRNA-Leu
    3105. Klebsiella pneumoniae subsp. pneumoniae KPNIH4 tRNA-Leu
    3106. Klebsiella pneumoniae subsp. pneumoniae KPNIH5 tRNA-Leu
    3107. Klebsiella pneumoniae subsp. pneumoniae KPNIH6 tRNA-Leu
    3108. Klebsiella pneumoniae subsp. pneumoniae KPNIH7 tRNA-Leu
    3109. Klebsiella pneumoniae subsp. pneumoniae KPNIH8 tRNA-Leu
    3110. Klebsiella pneumoniae subsp. pneumoniae KPNIH9 tRNA-Leu
    3111. Klebsiella pneumoniae subsp. pneumoniae KpO3210 tRNA-Leu
    3112. Klebsiella pneumoniae subsp. pneumoniae KPR0928 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3113. Klebsiella pneumoniae subsp. pneumoniae MGH 78578 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3114. Klebsiella pneumoniae subsp. pneumoniae MP14 tRNA-Leu
    3115. Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3116. Klebsiella pneumoniae subsp. pneumoniae PittNDM01 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3117. Klebsiella pneumoniae subsp. pneumoniae SA1 tRNA-Leu
    3118. Klebsiella pneumoniae subsp. pneumoniae ST258-K26BO tRNA-Leu-TAG
    3119. Klebsiella pneumoniae subsp. pneumoniae tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3120. Klebsiella pneumoniae subsp. pneumoniae UKKV901664 tRNA-Leu
    3121. Klebsiella pneumoniae subsp. pneumoniae WGLW1 tRNA-Leu
    3122. Klebsiella pneumoniae subsp. pneumoniae WGLW2 tRNA-Leu
    3123. Klebsiella pneumoniae subsp. pneumoniae WGLW3 tRNA-Leu
    3124. Klebsiella pneumoniae subsp. pneumoniae WGLW5 tRNA-Leu
    3125. Klebsiella pneumoniae subsp. rhinoscleromatis ATCC 13884 tRNA-Leu
    3126. Klebsiella pneumoniae subsp. rhinoscleromatis tRNA-Leu(tag)
    3127. Klebsiella pneumoniae tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3128. Klebsiella pneumoniae UCI 17 tRNA-Leu
    3129. Klebsiella pneumoniae UCI 19 tRNA-Leu
    3130. Klebsiella pneumoniae UCI 20 tRNA-Leu
    3131. Klebsiella pneumoniae UCI 21 tRNA-Leu
    3132. Klebsiella pneumoniae UCI 22 tRNA-Leu
    3133. Klebsiella pneumoniae UCI 25 tRNA-Leu
    3134. Klebsiella pneumoniae UCI 26 tRNA-Leu
    3135. Klebsiella pneumoniae UCI 33 tRNA-Leu
    3136. Klebsiella pneumoniae UCI 34 tRNA-Leu
    3137. Klebsiella pneumoniae UCI 37 tRNA-Leu
    3138. Klebsiella pneumoniae UCI 38 tRNA-Leu
    3139. Klebsiella pneumoniae UCI 41 tRNA-Leu
    3140. Klebsiella pneumoniae UCI 42 tRNA-Leu
    3141. Klebsiella pneumoniae UCI 43 tRNA-Leu
    3142. Klebsiella pneumoniae UCI 44 tRNA-Leu
    3143. Klebsiella pneumoniae UCI 55 tRNA-Leu
    3144. Klebsiella pneumoniae UCI 56 tRNA-Leu
    3145. Klebsiella pneumoniae UCI 59 tRNA-Leu
    3146. Klebsiella pneumoniae UCI 60 tRNA-Leu
    3147. Klebsiella pneumoniae UCI 61 tRNA-Leu
    3148. Klebsiella pneumoniae UCI 62 tRNA-Leu
    3149. Klebsiella pneumoniae UCI 63 tRNA-Leu
    3150. Klebsiella pneumoniae UCI 64 tRNA-Leu
    3151. Klebsiella pneumoniae UCI 67 tRNA-Leu
    3152. Klebsiella pneumoniae UCI 68 tRNA-Leu
    3153. Klebsiella pneumoniae UCICRE 13 tRNA-Leu
    3154. Klebsiella pneumoniae UCICRE 1 tRNA-Leu
    3155. Klebsiella pneumoniae UCICRE 2 tRNA-Leu
    3156. Klebsiella pneumoniae UCICRE 4 tRNA-Leu
    3157. Klebsiella pneumoniae UCICRE 6 tRNA-Leu
    3158. Klebsiella pneumoniae UCICRE 7 tRNA-Leu
    3159. Klebsiella pneumoniae UCICRE 8 tRNA-Leu
    3160. Klebsiella pneumoniae UHKPC01 tRNA-Leu
    3161. Klebsiella pneumoniae UHKPC02 tRNA-Leu
    3162. Klebsiella pneumoniae UHKPC04 tRNA-Leu
    3163. Klebsiella pneumoniae UHKPC05 tRNA-Leu
    3164. Klebsiella pneumoniae UHKPC06 tRNA-Leu
    3165. Klebsiella pneumoniae UHKPC07 tRNA-Leu
    3166. Klebsiella pneumoniae UHKPC09 tRNA-Leu
    3167. Klebsiella pneumoniae UHKPC179 tRNA-Leu
    3168. Klebsiella pneumoniae UHKPC17 tRNA-Leu
    3169. Klebsiella pneumoniae UHKPC18 tRNA-Leu
    3170. Klebsiella pneumoniae UHKPC22 tRNA-Leu
    3171. Klebsiella pneumoniae UHKPC23 tRNA-Leu
    3172. Klebsiella pneumoniae UHKPC24 tRNA-Leu
    3173. Klebsiella pneumoniae UHKPC26 tRNA-Leu
    3174. Klebsiella pneumoniae UHKPC27 tRNA-Leu
    3175. Klebsiella pneumoniae UHKPC28 tRNA-Leu
    3176. Klebsiella pneumoniae UHKPC29 tRNA-Leu
    3177. Klebsiella pneumoniae UHKPC31 tRNA-Leu
    3178. Klebsiella pneumoniae UHKPC32 tRNA-Leu
    3179. Klebsiella pneumoniae UHKPC33 tRNA-Leu
    3180. Klebsiella pneumoniae UHKPC40 tRNA-Leu
    3181. Klebsiella pneumoniae UHKPC45 tRNA-Leu
    3182. Klebsiella pneumoniae UHKPC47 tRNA-Leu
    3183. Klebsiella pneumoniae UHKPC48 tRNA-Leu
    3184. Klebsiella pneumoniae UHKPC 52 tRNA-Leu
    3185. Klebsiella pneumoniae UHKPC57 tRNA-Leu
    3186. Klebsiella pneumoniae UHKPC59 tRNA-Leu
    3187. Klebsiella pneumoniae UHKPC61 tRNA-Leu
    3188. Klebsiella pneumoniae UHKPC67 tRNA-Leu
    3189. Klebsiella pneumoniae UHKPC69 tRNA-Leu
    3190. Klebsiella pneumoniae UHKPC77 tRNA-Leu
    3191. Klebsiella pneumoniae UHKPC81 tRNA-Leu
    3192. Klebsiella pneumoniae UHKPC96 tRNA-Leu
    3193. Klebsiella pneumoniae VA360 tRNA-Leu
    3194. Klebsiella pneumoniae VAKPC252 tRNA-Leu
    3195. Klebsiella pneumoniae VAKPC254 tRNA-Leu
    3196. Klebsiella pneumoniae VAKPC269 tRNA-Leu
    3197. Klebsiella pneumoniae VAKPC270 tRNA-Leu
    3198. Klebsiella pneumoniae VAKPC276 tRNA-Leu
    3199. Klebsiella pneumoniae VAKPC278 tRNA-Leu
    3200. Klebsiella pneumoniae VAKPC280 tRNA-Leu
    3201. Klebsiella pneumoniae VAKPC297 tRNA-Leu
    3202. Klebsiella pneumoniae VAKPC309 tRNA-Leu
    3203. Klebsiella quasipneumoniae subsp. quasipneumoniae tRNA-Leu
    3204. Klebsiella quasipneumoniae subsp. similipneumoniae tRNA-Leu
    3205. Klebsiella quasipneumoniae tRNA-Leu(tag)
    3206. Klebsiella quasivariicola tRNA-Leu(tag)
    3207. Klebsiella sp. CVUAS 11263 tRNA-Leu
    3208. Klebsiella sp. 4_1_44FAA tRNA-Leu
    3209. Klebsiella sp. AA405 tRNA-Leu
    3210. Klebsiella sp. Acro-833 tRNA-Leu
    3211. Klebsiella spallanzanii tRNA-Leu(tag)
    3212. Klebsiella sp. A-Nf5 tRNA-Leu
    3213. Klebsiella sp. AS10 tRNA-Leu
    3214. Klebsiella sp. BDA134-6 tRNA-Leu
    3215. Klebsiella sp. B-Nf7 tRNA-Leu
    3216. Klebsiella sp. C1-16S-Nf17 tRNA-Leu
    3217. Klebsiella sp. C-Nf10 tRNA-Leu
    3218. Klebsiella sp. CVUAS 10975.2 tRNA-Leu
    3219. Klebsiella sp. CVUAS 5466.2 tRNA-Leu
    3220. Klebsiella sp. CVUAS 8534.2 tRNA-Leu
    3221. Klebsiella sp. D-Nf1 tRNA-Leu
    3222. Klebsiella sp. DNRA6 tRNA-Leu
    3223. Klebsiella sp. E-Nf3 tRNA-Leu
    3224. Klebsiella sp. FDAARGOS_511 tRNA-Leu
    3225. Klebsiella sp. F-Nf9 tRNA-Leu
    3226. Klebsiella sp. G2-16S-Nf13 tRNA-Leu
    3227. Klebsiella sp. GL120222-02 tRNA-Leu
    3228. Klebsiella sp. G-Nf4 tRNA-Leu
    3229. Klebsiella sp. HMSC09D12 tRNA-Leu
    3230. Klebsiella sp. HMSC16A12 tRNA-Leu
    3231. Klebsiella sp. HMSC16C06 tRNA-Leu
    3232. Klebsiella sp. HMSC22F09 tRNA-Leu
    3233. Klebsiella sp. HMSC25G12 tRNA-Leu
    3234. Klebsiella sp. H-Nf2 tRNA-Leu
    3235. Klebsiella sp. I-Nf8 tRNA-Leu
    3236. Klebsiella sp. JL973 tRNA-Leu
    3237. Klebsiella sp. J-Nf11 tRNA-Leu
    3238. Klebsiella sp. K4 tRNA-Leu
    3239. Klebsiella sp. K5 tRNA-Leu
    3240. Klebsiella sp. KBG1 tRNA-Leu
    3241. Klebsiella sp. Kd70 TUC-EEAOC tRNA-Leu
    3242. Klebsiella sp. KG9 tRNA-Leu
    3243. Klebsiella sp. K-Nf6 tRNA-Leu
    3244. Klebsiella sp. Kpp tRNA-Leu
    3245. Klebsiella sp. Kps tRNA-Leu
    3246. Klebsiella sp. KTE92 tRNA-Leu
    3247. Klebsiella sp. LTGPAF-6F tRNA-Leu
    3248. Klebsiella sp. LY tRNA-Leu
    3249. Klebsiella sp. M5al tRNA-Leu
    3250. Klebsiella sp. MBT K-1 tRNA-Leu
    3251. Klebsiella sp. MC1F tRNA-Leu
    3252. Klebsiella sp. ME-303 tRNA-Leu
    3253. Klebsiella sp. MPUS7 tRNA-Leu
    3254. Klebsiella sp. MS 92-3 tRNA-Leu
    3255. Klebsiella sp. NFIX53 tRNA-Leu
    3256. Klebsiella sp. OBRC7 tRNA-Leu
    3257. Klebsiella sp. P1927 tRNA-Leu
    3258. Klebsiella sp. P1954 tRNA-Leu
    3259. Klebsiella sp. P1CD1 tRNA-Leu
    3260. Klebsiella sp. PL-2018 tRNA-Leu
    3261. Klebsiella sp. PO552 tRNA-Leu
    3262. Klebsiella sp. RC2 tRNA-Leu
    3263. Klebsiella sp. RCJ4 tRNA-Leu
    3264. Klebsiella sp. RHBSTW-00215 tRNA-Leu
    3265. Klebsiella sp. RHBSTW-00464 tRNA-Leu
    3266. Klebsiella sp. RHBSTW-00465 tRNA-Leu
    3267. Klebsiella sp. RHBSTW-00484 tRNA-Leu
    3268. Klebsiella sp. RIT-PI-d tRNA-Leu
    3269. Klebsiella sp. S1 tRNA-Leu
    3270. Klebsiella sp. STW0522-44 tRNA-Leu
    3271. Klebsiella sp. T11 tRNA-Leu
    3272. Klebsiella sp. TF21-TM tRNA-Leu
    3273. Klebsiella indica tRNA-Leu
    3274. Klebsiella sp. tRNA-Leu
    3275. Klebsiella huaxiensis tRNA-Leu(tag)
    3276. Klebsiella sp. WP3-S18-ESBL-05 tRNA-Leu
    3277. Klebsiella sp. WP3-W18-ESBL-02 tRNA-Leu
    3278. Klebsiella sp. WP4-W18-ESBL-05 tRNA-Leu
    3279. Klebsiella sp. WP7-S18-CRE-02 tRNA-Leu
    3280. Klebsiella sp. WP7-S18-CRE-03 tRNA-Leu
    3281. Klebsiella sp. WP7-S18-ESBL-04 tRNA-Leu
    3282. Klebsiella sp. WP8-S18-ESBL-06 tRNA-Leu
    3283. Klebsiella sp. X1-16S-Nf21 tRNA-Leu
    3284. Klebsiella sp. Z2 tRNA-Leu
    3285. Klebsiella variicola At-22 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3286. Klebsiella variicola BIDMC 61 tRNA-Leu
    3287. Klebsiella variicola CAG:634 transfer RNA-Leu(TAG)
    3288. Klebsiella variicola MGH 68 tRNA-Leu
    3289. Klebsiella variicola MGH 80 tRNA-Leu
    3290. Klebsiella variicola subsp. variicola tRNA-Leu
    3291. Klebsiella variicola tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3292. Klebsiella variicola UCI 18 tRNA-Leu
    3293. Kluyvera ascorbata ATCC 33433 tRNA-Leu
    3294. Kluyvera ascorbata tRNA-Leu(tag)
    3295. Kluyvera cryocrescens tRNA-Leu(tag)
    3296. Kluyvera genomosp. 3 tRNA-Leu
    3297. Kluyvera georgiana ATCC 51603 tRNA-Leu
    3298. Kluyvera georgiana tRNA-Leu
    3299. Kluyvera intermedia tRNA-Leu
    3300. [Kluyvera] intestini tRNA-Leu
    3301. Kluyvera sichuanensis tRNA-Leu
    3302. Kluyvera sp. Nf5 tRNA-Leu
    3303. Kosakonia cowanii tRNA-Leu
    3304. Kosakonia oryzae tRNA-Leu
    3305. Kosakonia oryzendophytica tRNA_Leu_TAG
    3306. Kosakonia oryziphila tRNA_Leu_TAG
    3307. Kosakonia pseudosacchari tRNA-Leu
    3308. Kosakonia radicincitans DSM 16656 tRNA-Leu
    3309. Kosakonia radicincitans tRNA-Leu-TAG
    3310. Kosakonia radicincitans UMEnt01/12 tRNA-Leu
    3311. Kosakonia radicincitans YD4 tRNA-Leu
    3312. Kosakonia sacchari SP1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3313. Kosakonia sacchari tRNA_Leu_TAG
    3314. Kosakonia sp. CCTCC M2018092 tRNA-Leu
    3315. Kosakonia sp. H7A tRNA-Leu
    3316. Kosakonia sp. MH5 tRNA-Leu
    3317. Kosakonia sp. MUSA4 tRNA-Leu
    3318. Kosakonia sp. S42 tRNA-Leu
    3319. Kosakonia sp. S58 tRNA-Leu
    3320. Kosakonia sp. SMBL-WEM22 tRNA-Leu
    3321. Kosakonia quasisacchari tRNA-Leu
    3322. Leclercia adecarboxylata ATCC 23216 = NBRC 102595 tRNA-Leu
    3323. Leclercia adecarboxylata tRNA-Leu(tag)
    3324. Leclercia sp. 119287 tRNA-Leu
    3325. Leclercia sp. 29361 tRNA-Leu
    3326. Leclercia sp. 4-9-1-25 tRNA-Leu
    3327. Leclercia sp. Colony189 tRNA-Leu
    3328. Leclercia sp. EMC7 tRNA-Leu
    3329. Leclercia sp. J807 tRNA-Leu
    3330. Leclercia sp. LK8 tRNA-Leu
    3331. Leclercia sp. LSNIH1 tRNA-Leu
    3332. Leclercia sp. LSNIH2 tRNA-Leu
    3333. Leclercia sp. LSNIH3 tRNA-Leu
    3334. Leclercia sp. LSNIH4 tRNA-Leu
    3335. Leclercia sp. LSNIH5 tRNA-Leu
    3336. Leclercia sp. LSNIH6 tRNA-Leu
    3337. Leclercia sp. LSNIH7 tRNA-Leu
    3338. Leclercia sp. LSNIH8 tRNA-Leu
    3339. Leclercia sp. tRNA-Leu
    3340. Leclercia sp. W17 tRNA-Leu
    3341. Leclercia sp. W6 tRNA-Leu
    3342. Lelliottia amnigena CHS 78 tRNA-Leu
    3343. Lelliottia amnigena tRNA-Leu
    3344. Lelliottia aquatilis tRNA-Leu
    3345. Lelliottia nimipressuralis tRNA-Leu
    3346. Lelliottia sp. 7254-16 tRNA-Leu
    3347. Lelliottia sp. F153 tRNA-Leu
    3348. Lelliottia sp. F154 tRNA-Leu
    3349. Lelliottia sp. F159 tRNA-Leu
    3350. Lelliottia sp. WB101 tRNA-Leu
    3351. Leminorella grimontii ATCC 33999 = DSM 5078 tRNA-Leu
    3352. Leminorella grimontii tRNA-Leu(tag)
    3353. Leminorella richardii tRNA-Leu(tag)
    3354. Listeria monocytogenes tRNA-Leu
    3355. Lonsdalea britannica tRNA-Leu
    3356. Lonsdalea iberica tRNA-Leu
    3357. Lonsdalea populi tRNA-Leu
    3358. Lonsdalea quercina tRNA_Leu_TAG
    3359. Mangrovibacter phragmitis tRNA-Leu
    3360. Mangrovibacter sp. MFB070 tRNA-Leu
    3361. Phytobacter massiliensis tRNA-Leu(tag)
    3362. Metakosakonia sp. MRY16-398 tRNA-Leu
    3363. Metakosakonia sp. tRNA-Leu
    3364. Methanosarcina mazei tRNA-Leu
    3365. Microbacterium sp. SUBG005 tRNA-Leu
    3366. Mixta calida tRNA-Leu
    3367. Mixta gaviniae tRNA-Leu
    3368. Mixta intestinalis tRNA-Leu
    3369. Mixta tenebrionis tRNA-Leu
    3370. Mixta theicola tRNA-Leu
    3371. Moellerella wisconsensis ATCC 35017 tRNA-Leu
    3372. Moellerella wisconsensis tRNA-Leu(tag)
    3373. Morganella morganii subsp. morganii KT tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3374. Morganella morganii subsp. morganii tRNA-Leu
    3375. Morganella morganii tRNA-Leu(tag)
    3376. Morganella sp. EGD-HP17 tRNA-Leu
    3377. Morganella sp. HMSC11D09 tRNA-Leu
    3378. Morganella sp. (in: Bacteria) tRNA-Leu
    3379. Musicola paradisiaca Ech703 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3380. Mycobacterium tuberculosis tRNA-Leu(tag)
    3381. Nissabacter archeti tRNA-Leu
    3382. Nissabacter sp. SGAir0207 tRNA-Leu
    3383. Oceanimonas baumannii tRNA-Leu
    3384. Oceanimonas doudoroffii tRNA-Leu
    3385. Oceanimonas sp. GK1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3386. Oceanimonas sp. MB9 tRNA-Leu
    3387. Pantoea agglomerans Eh318 tRNA-Leu
    3388. Pantoea agglomerans tRNA-Leu
    3389. Pantoea agglomerans Tx10 tRNA-Leu
    3390. Pantoea alhagi tRNA-Leu
    3391. Pantoea allii tRNA-Leu
    3392. Pantoea ananatis AJ13355 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3393. Pantoea ananatis BRT175 tRNA-Leu
    3394. Pantoea ananatis LMG 20103 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3395. Pantoea ananatis LMG 5342 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3396. Pantoea ananatis PA13 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3397. Pantoea ananatis tRNA_Leu_TAG
    3398. Pantoea anthophila tRNA-Leu
    3399. Pantoea brenneri tRNA-Leu
    3400. Mixta calida B021323 (Mixta calida B021323) tRNA-Leu
    3401. Pantoea coffeiphila tRNA-Leu
    3402. Pantoea conspicua tRNA-Leu
    3403. Pantoea cypripedii tRNA-Leu
    3404. Pantoea deleyi tRNA-Leu
    3405. Pantoea dispersa 625 tRNA-Leu
    3406. Pantoea dispersa EGD-AAK13 tRNA-Leu
    3407. Pantoea dispersa tRNA-Leu
    3408. Pantoea eucalypti tRNA-Leu
    3409. Pantoea eucrina tRNA-Leu
    3410. Pantoea jilinensis tRNA-Leu
    3411. Pantoea latae tRNA-Leu
    3412. Pantoea rwandensis tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3413. Pantoea sp. 111 tRNA-Leu
    3414. Pantoea sp. 1B4 tRNA-Leu
    3415. Pantoea sp. 3_1284 tRNA-Leu
    3416. Pantoea sp. aB tRNA-Leu
    3417. Pantoea sp. Acro-807 tRNA-Leu
    3418. Pantoea sp. Ae16 tRNA-Leu
    3419. Pantoea sp. AlfR4 tRNA-Leu
    3420. Pantoea sp. AlfR5 tRNA-Leu
    3421. Pantoea sp. AMG 501 tRNA-Leu
    3422. Pantoea sp. ARC270 tRNA-Leu
    3423. Pantoea sp. ARC607 tRNA-Leu
    3424. Pantoea sp. At-9b tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3425. Pantoea sp. AV62 tRNA-Leu
    3426. Pantoea sp. B_10 tRNA-Leu
    3427. Pantoea sp. B_2 tRNA-Leu
    3428. Pantoea sp. B_8 tRNA-Leu
    3429. Pantoea sp. B_9 tRNA-Leu
    3430. Pantoea sp. BL1 tRNA-Leu
    3431. Pantoea sp. Bo_10 tRNA-Leu
    3432. Pantoea sp. Bo_11 tRNA-Leu
    3433. Pantoea sp. Bo_13 tRNA-Leu
    3434. Pantoea sp. Bo_14 tRNA-Leu
    3435. Pantoea sp. Bo_19 tRNA-Leu
    3436. Pantoea sp. Bo_21 tRNA-Leu
    3437. Pantoea sp. Bo_2 tRNA-Leu
    3438. Pantoea sp. Bo_34a tRNA-Leu
    3439. Pantoea sp. Bo_39 tRNA-Leu
    3440. Pantoea sp. Bo_3 tRNA-Leu
    3441. Pantoea sp. Bo_40 tRNA-Leu
    3442. Pantoea sp. Bo_46 tRNA-Leu
    3443. Pantoea sp. Bo_5 tRNA-Leu
    3444. Pantoea sp. Bo_7 tRNA-Leu
    3445. Pantoea sp. BRM17 tRNA-Leu
    3446. Pantoea sp. CFSAN033090 tRNA-Leu
    3447. Pantoea sp. F_11 tRNA-Leu
    3448. Pantoea sp. F_12 tRNA-Leu
    3449. Pantoea sp. F_14 tRNA-Leu
    3450. Pantoea sp. F_15 tRNA-Leu
    3451. Pantoea sp. F_16 tRNA-Leu
    3452. Pantoea sp. F_17 tRNA-Leu
    3453. Pantoea sp. F_18 tRNA-Leu
    3454. Pantoea sp. F_5 tRNA-Leu
    3455. Pantoea sp. F_7 tRNA-Leu
    3456. Pantoea sp. FDAARGOS_194 tRNA-Leu
    3457. Pantoea sp. FN_2b tRNA-Leu
    3458. Pantoea sp. GL120224-02 tRNA_Leu_TAG
    3459. Pantoea sp. ICBG 1758 tRNA-Leu
    3460. Pantoea sp. ICBG 828 tRNA-Leu
    3461. Pantoea sp. ICBG 985 tRNA-Leu
    3462. Pantoea sp. (indoor metagenome) tRNA-Leu
    3463. Pantoea sp. JGM49 tRNA-Leu
    3464. [Pantoea] beijingensis tRNA-Leu
    3465. Pantoea sp. LS15 tRNA-Leu
    3466. Pantoea sp. M_10 tRNA-Leu
    3467. Pantoea sp. M_1 tRNA-Leu
    3468. Pantoea sp. M_3 tRNA-Leu
    3469. Pantoea sp. M_5 tRNA-Leu
    3470. Pantoea sp. M_6 tRNA-Leu
    3471. Pantoea sp. M_8 tRNA-Leu
    3472. Pantoea sp. M_9 tRNA-Leu
    3473. Pantoea sp. Morm (symbiont metagenome) tRNA-Leu
    3474. Pantoea sp. MSR2 tRNA-Leu
    3475. Pantoea sp. MT58 tRNA-Leu
    3476. Pantoea sp. OXWO6B1 tRNA-Leu
    3477. Pantoea sp. paga tRNA-Leu
    3478. Pantoea sp. Pent tRNA-Leu
    3479. Pantoea sp. PNT01 tRNA-Leu
    3480. Pantoea sp. PSNIH1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3481. Pantoea sp. PSNIH2 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3482. Pantoea sp. PSNIH3 tRNA-Leu
    3483. Pantoea sp. PSNIH4 tRNA-Leu
    3484. Pantoea sp. PSNIH5 tRNA-Leu
    3485. Pantoea sp. PSNIH6 tRNA-Leu
    3486. Pantoea sp. R102 tRNA-Leu
    3487. Pantoea sp. RIT388 tRNA-Leu
    3488. Pantoea sp. RIT 413 tRNA-Leu
    3489. Pantoea sp. Seng tRNA-Leu
    3490. Pantoea sp. SM3640 tRNA-Leu
    3491. Pantoea sp. SM3 tRNA-Leu
    3492. Pantoea sp. Taur tRNA-Leu
    3493. Pantoea sp. VH_16 tRNA-Leu
    3494. Pantoea sp. VH_18 tRNA-Leu
    3495. Pantoea sp. VH_25 tRNA-Leu
    3496. Pantoea sp. VH_3 tRNA-Leu
    3497. Pantoea sp. VH_4 tRNA-Leu
    3498. Pantoea sp. VH_8 tRNA-Leu
    3499. Pantoea sp. VS1 tRNA-Leu
    3500. Pantoea sp. WMus005 tRNA-Leu
    3501. Pantoea sp. YU22 tRNA-Leu
    3502. Pantoea stewartii subsp. indologenes tRNA-Leu
    3503. Pantoea stewartii subsp. stewartii DC283 tRNA-Leu
    3504. Pantoea stewartii subsp. stewartii tRNA-Leu
    3505. Pantoea stewartii tRNA-Leu
    3506. Pantoea vagans C9-1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3507. Pantoea vagans tRNA-Leu
    3508. Pantoea wallisii tRNA-Leu
    3509. Pectobacterium aquaticum tRNA-Leu
    3510. Pectobacterium aroidearum tRNA-Leu
    3511. Pectobacterium atrosepticum ICMP 1526 tRNA-Leu
    3512. Pectobacterium atrosepticum SCRI1043 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3513. Pectobacterium atrosepticum tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3514. Pectobacterium betavasculorum tRNA-Leu
    3515. Pectobacterium carotovorum (Erwinia carotovora) tRNA-Leu
    3516. Pectobacterium actinidiae tRNA-Leu
    3517. Pectobacterium brasiliense tRNA-Leu
    3518. Pectobacterium brasiliense ICMP 19477 tRNA-Leu
    3519. Pectobacterium carotovorum subsp. carotovorum ICMP 5702 tRNA-Leu
    3520. Pectobacterium carotovorum subsp. carotovorum PC1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3521. Pectobacterium carotovorum subsp. carotovorum PCC21 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3522. Pectobacterium carotovorum subsp. carotovorum tRNA-Leu
    3523. Pectobacterium carotovorum subsp. carotovorum UGC32 tRNA-Leu
    3524. Pectobacterium odoriferum tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3525. Pectobacterium parmentieri tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3526. Pectobacterium parmentieri WPP163 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3527. Pectobacterium peruviense tRNA-Leu
    3528. Pectobacterium polaris tRNA-Leu
    3529. Pectobacterium polonicum tRNA-Leu
    3530. Pectobacterium punjabense tRNA-Leu
    3531. Pectobacterium quasiaquaticum tRNA-Leu
    3532. Pectobacterium sp. CFBP8739 tRNA-Leu
    3533. Pectobacterium versatile tRNA-Leu
    3534. Pectobacterium wasabiae CFBP 3304 tRNA-Leu
    3535. Pectobacterium wasabiae tRNA-Leu
    3536. Pedobacter himalayensis tRNA-Leu
    3537. Photorhabdus akhurstii tRNA-Leu
    3538. Photorhabdus asymbiotica tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3539. Photorhabdus australis tRNA-Leu
    3540. Photorhabdus bodei tRNA-Leu
    3541. Photorhabdus cinerea tRNA-Leu
    3542. Photorhabdus heterorhabditis tRNA-Leu
    3543. Photorhabdus kayaii tRNA-Leu
    3544. Photorhabdus khanii NC19 tRNA-Leu
    3545. Photorhabdus laumondii subsp. clarkei tRNA-Leu
    3546. Photorhabdus laumondii subsp. laumondii tRNA-Leu
    3547. Photorhabdus laumondii subsp. laumondii TTO1 transfert RNA-Leu
    3548. Photorhabdus aegyptia tRNA-Leu
    3549. Photorhabdus luminescens subsp. luminescens tRNA-Leu
    3550. Photorhabdus luminescens subsp. sonorensis tRNA-Leu
    3551. Photorhabdus luminescens tRNA_Leu_TAG
    3552. Photorhabdus sp. HUG-39 tRNA-Leu
    3553. Photorhabdus luminescens subsp. mexicana tRNA-Leu
    3554. Photorhabdus sp. RW14-46 tRNA-Leu
    3555. Photorhabdus sp. S10-54 tRNA-Leu
    3556. Photorhabdus sp. S12-55 tRNA-Leu
    3557. Photorhabdus sp. S14-60 tRNA-Leu
    3558. Photorhabdus sp. S15-56 tRNA-Leu
    3559. Photorhabdus sp. S5P8-50 tRNA-Leu
    3560. Photorhabdus sp. S7-51 tRNA-Leu
    3561. Photorhabdus sp. S8-52 tRNA-Leu
    3562. Photorhabdus sp. S9-53 tRNA-Leu
    3563. Photorhabdus stackebrandtii tRNA-Leu
    3564. Photorhabdus temperata J3 tRNA-Leu
    3565. Photorhabdus temperata subsp. temperata M1021 tRNA-Leu
    3566. Photorhabdus temperata subsp. temperata Meg1 tRNA-Leu
    3567. Photorhabdus temperata tRNA-Leu
    3568. Photorhabdus thracensis tRNA-Leu
    3569. Phytobacter diazotrophicus tRNA-Leu
    3570. Phytobacter ursingii tRNA-Leu
    3571. Plautia stali symbiont tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3572. Pluralibacter gergoviae tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3573. Pragia fontium DSM 5563 = ATCC 49100 tRNA_Leu_TAG
    3574. Pragia fontium tRNA-Leu
    3575. Proteus alimentorum tRNA-Leu
    3576. Proteus terrae subsp. cibarius tRNA-Leu
    3577. Proteus columbae tRNA-Leu
    3578. Proteus hauseri ATCC 700826 tRNA-Leu
    3579. Proteus hauseri tRNA-Leu
    3580. Proteus mirabilis ATCC 29906 tRNA-Leu
    3581. Proteus mirabilis BB2000 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
    3582. Proteus mirabilis HI4320 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
    3583. Proteus mirabilis tRNA-Leu
    3584. Proteus mirabilis WGLW4 tRNA-Leu
    3585. Proteus mirabilis WGLW6 tRNA-Leu
    3586. Proteus penneri ATCC 35198 tRNA-Leu
    3587. Proteus penneri tRNA-Leu(tag)
    3588. Proteus sp. G2615 tRNA-Leu
    3589. Proteus sp. G2639 tRNA-Leu
    3590. Proteus sp. G2657 tRNA-Leu
    3591. Proteus sp. G2658 tRNA-Leu
    3592. Proteus sp. G2660 tRNA-Leu
    3593. Proteus sp. G2667 tRNA-Leu
    3594. Proteus sp. G2674 tRNA-Leu
    3595. Proteus sp. G2675 tRNA-Leu
    3596. Proteus sp. G4379 tRNA-Leu
    3597. Proteus sp. G4400 tRNA-Leu
    3598. Proteus sp. G4408 tRNA-Leu
    3599. Proteus sp. G4441 tRNA-Leu
    3600. Proteus sp. G4445 tRNA-Leu
    3601. Proteus sp. G4468 tRNA-Leu
    3602. Proteus sp. GOKU tRNA-Leu
    3603. Proteus sp. HMSC10D02 tRNA-Leu
    3604. Proteus sp. HMSC14B05 tRNA-Leu
    3605. Proteus sp. PR00174 tRNA-Leu
    3606. Proteus sp. PR00208 tRNA-Leu
    3607. Proteus sp. PR00224 tRNA-Leu
    3608. Proteus sp. ZN5 tRNA-Leu
    3609. Proteus terrae tRNA-Leu
    3610. Proteus vulgaris tRNA-Leu
    3611. Providencia burhodogranariea DSM 19968 tRNA-Leu
    3612. Providencia sneebia DSM 19967 tRNA-Leu
    3613. Providencia sp. 2.29 tRNA-Leu
    3614. Providencia sp. wls1948 tRNA-Leu
    3615. Providencia sp. wls1949 tRNA-Leu
    3616. Providencia stuartii MRSN 2154 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3617. Providencia stuartii tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3618. Providencia thailandensis tRNA-Leu
    3619. Providencia vermicola tRNA-Leu
    3620. Pseudescherichia vulneris tRNA-Leu(tag)
    3621. Pseudocitrobacter faecalis tRNA-Leu
    3622. Pseudocitrobacter sp. 73 tRNA-Leu
    3623. Pseudocitrobacter sp. RIT 415 tRNA-Leu
    3624. Pseudomonas aeruginosa tRNA-Leu
    3625. Pseudomonas sp. SWRI144 tRNA-Leu
    3626. Pseudomonas tritici tRNA-Leu
    3627. Raoultella electrica tRNA-Leu
    3628. Raoultella ornithinolytica 10-5246 tRNA-Leu
    3629. Raoultella ornithinolytica 2-156-04_S1_C1 tRNA-Leu
    3630. Raoultella ornithinolytica 2-156-04_S1_C2 tRNA-Leu
    3631. Raoultella ornithinolytica B6 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3632. Raoultella ornithinolytica tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3633. Raoultella planticola ATCC 33531 tRNA-Leu
    3634. Raoultella planticola tRNA-Leu(tag)
    3635. Raoultella sp. 10-1 tRNA-Leu
    3636. Raoultella sp. Lac1 tRNA-Leu
    3637. Raoultella sp. Lac2 tRNA-Leu
    3638. Raoultella sp. RIT712 tRNA-Leu
    3639. Raoultella sp. RLT01 tRNA-Leu
    3640. Raoultella sp. T31 tRNA-Leu
    3641. Raoultella sp. X13 tRNA-Leu
    3642. Raoultella sp. XY-1 tRNA-Leu
    3643. Raoultella terrigena tRNA-Leu(tag)
    3644. Riemerella anatipestifer tRNA-Leu
    3645. Salmonella bongori CFSAN000510 tRNA-Leu
    3646. Salmonella bongori N268-08 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3647. Salmonella bongori NCTC 12419 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3648. Salmonella bongori serovar 40:z35:- str. 95-0123 tRNA-Leu
    3649. Salmonella bongori serovar 40:z35:- tRNA-Leu
    3650. Salmonella bongori serovar 44:r:- tRNA-Leu
    3651. Salmonella bongori serovar 48:i:- str. 94-0708 tRNA-Leu
    3652. Salmonella bongori serovar 48:i:- tRNA-Leu
    3653. Salmonella bongori serovar 48:z35:- tRNA-Leu
    3654. Salmonella bongori serovar 48:z41:-- str. RKS3044 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3655. Salmonella bongori serovar 66:z41:- str. SA19983605 tRNA-Leu
    3656. Salmonella bongori serovar 66:z65:- tRNA-Leu
    3657. Salmonella bongori tRNA-Leu(tag)
    3658. Salmonella enterica subsp. arizonae serovar [1],13,23:g,z51:- tRNA-Leu
    3659. Salmonella enterica subsp. arizonae serovar 13,22:z4,z23:- tRNA-Leu
    3660. Salmonella enterica subsp. arizonae serovar 13,23:gz51:- tRNA-Leu
    3661. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 32450 tRNA-Leu
    3662. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 32457 tRNA-Leu
    3663. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43478 tRNA-Leu
    3664. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43479 tRNA-Leu
    3665. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43480 tRNA-Leu
    3666. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43481 tRNA-Leu
    3667. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43482 tRNA-Leu
    3668. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18383 tRNA-Leu
    3669. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18503 tRNA-Leu
    3670. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18554 tRNA-Leu
    3671. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N20028 tRNA-Leu
    3672. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N23850 tRNA-Leu
    3673. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N25373 tRNA-Leu
    3674. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26624 tRNA-Leu
    3675. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26625 tRNA-Leu
    3676. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26626 tRNA-Leu
    3677. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26928 tRNA-Leu
    3678. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N27 tRNA-Leu
    3679. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N29354 tRNA-Leu
    3680. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N4410 tRNA-Leu
    3681. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N5 tRNA-Leu
    3682. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N6509 tRNA-Leu
    3683. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N7307 tRNA-Leu
    3684. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N9135 tRNA-Leu
    3685. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- tRNA-Leu
    3686. Salmonella enterica subsp. arizonae serovar 18:z4,z32:- tRNA-Leu
    3687. Salmonella enterica subsp. arizonae serovar 21:z4,z23:- tRNA-Leu
    3688. Salmonella enterica subsp. arizonae serovar 38:z4,z23:- tRNA-Leu
    3689. Salmonella enterica subsp. arizonae serovar 40:z36:- tRNA-Leu
    3690. Salmonella enterica subsp. arizonae serovar 40:z4,z23:- tRNA-Leu
    3691. Salmonella enterica subsp. arizonae serovar 40:z4,z24: tRNA-Leu
    3692. Salmonella enterica subsp. arizonae serovar 41:z4,z23:- str. 01-0089 tRNA-Leu
    3693. Salmonella enterica subsp. arizonae serovar 41:z4,z23:- tRNA-Leu
    3694. Salmonella enterica subsp. arizonae serovar 41:z4,z32:- tRNA-Leu
    3695. Salmonella enterica subsp. arizonae serovar 44:z4,z23,z32:- tRNA-Leu
    3696. Salmonella enterica subsp. arizonae serovar 47:z4,z23:- tRNA-Leu
    3697. Salmonella enterica subsp. arizonae serovar 48:z4,z24:- tRNA-Leu
    3698. Salmonella enterica subsp. arizonae serovar 50:r:z tRNA-Leu
    3699. Salmonella enterica subsp. arizonae serovar 51:g,z51:- tRNA-Leu
    3700. Salmonella enterica subsp. arizonae serovar 53:-:- str. SA20100345 tRNA-Leu
    3701. Salmonella enterica subsp. arizonae serovar 56:z4,z23:- tRNA-Leu
    3702. Salmonella enterica subsp. arizonae serovar 62:z36:- str. 5335/86 tRNA-Leu
    3703. Salmonella enterica subsp. arizonae serovar 62:z36:- str. RKS2983 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3704. Salmonella enterica subsp. arizonae serovar 62:z36:- tRNA-Leu
    3705. Salmonella enterica subsp. arizonae serovar 62:z4,z23:- tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3706. Salmonella enterica subsp. arizonae serovar 63:g,z51:- str. So 20/20 tRNA-Leu
    3707. Salmonella enterica subsp. arizonae str. CFSAN000560 tRNA-Leu
    3708. Salmonella enterica subsp. arizonae tRNA-Leu(tag)
    3709. Salmonella enterica subsp. diarizonae serovar 11:k:z53 tRNA-Leu
    3710. Salmonella enterica subsp. diarizonae serovar 16:z10:e,n,x,z15 tRNA-Leu
    3711. Salmonella enterica subsp. diarizonae serovar 35:k:e,n,x,z15 tRNA-Leu
    3712. Salmonella enterica subsp. diarizonae serovar 38:[k]:- tRNA-Leu
    3713. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35 tRNA-Leu
    3714. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35:- tRNA-Leu
    3715. Salmonella enterica subsp. diarizonae serovar 38:k:z tRNA-Leu
    3716. Salmonella enterica subsp. diarizonae serovar 47:k:z35 tRNA-Leu
    3717. Salmonella enterica subsp. diarizonae serovar 47:k:z53:[z84] tRNA-Leu
    3718. Salmonella enterica subsp. diarizonae serovar 48:i:z tRNA-Leu
    3719. Salmonella enterica subsp. diarizonae serovar 48:z52:z tRNA-Leu
    3720. Salmonella enterica subsp. diarizonae serovar 50:k:z str. MZ0080 tRNA-Leu
    3721. Salmonella enterica subsp. diarizonae serovar 50:k:z tRNA-Leu
    3722. Salmonella enterica subsp. diarizonae serovar 50:k:z:[z50],[z57],[z68], [z86] tRNA-Leu
    3723. Salmonella enterica subsp. diarizonae serovar 50:l,v:z35 tRNA-Leu
    3724. Salmonella enterica subsp. diarizonae serovar 50:r:z tRNA-Leu
    3725. Salmonella enterica subsp. diarizonae serovar 50:z:z52 tRNA-Leu
    3726. Salmonella enterica subsp. diarizonae serovar 53:r:z35 tRNA-Leu
    3727. Salmonella enterica subsp. diarizonae serovar 53:z10:- tRNA-Leu
    3728. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 str. 01-0170 tRNA-Leu
    3729. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 tRNA-Leu
    3730. Salmonella enterica subsp. diarizonae serovar 61:-:1,5,7 tRNA-Leu
    3731. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,(7) tRNA-Leu
    3732. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,7 tRNA-Leu
    3733. Salmonella enterica subsp. diarizonae serovar 61:l,v:1,5,7 tRNA-Leu
    3734. Salmonella enterica subsp. diarizonae serovar 61:l,[v],[z13]:1,5,[7] tRNA-Leu
    3735. Salmonella enterica subsp. diarizonae serovar 61:l,v:z35 tRNA-Leu
    3736. Salmonella enterica subsp. diarizonae serovar 61:r:z53 tRNA-Leu
    3737. Salmonella enterica subsp. diarizonae serovar 61:r:z tRNA-Leu
    3738. Salmonella enterica subsp. diarizonae serovar 61:z52:z53 tRNA-Leu
    3739. Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 tRNA-Leu
    3740. Salmonella enterica subsp. diarizonae serovar 65:z10:e,n,x,z15 tRNA-Leu
    3741. Salmonella enterica subsp. diarizonae serovar b,50:-:- tRNA-Leu
    3742. Salmonella enterica subsp. diarizonae serovar Rough:r:z tRNA-Leu
    3743. Salmonella enterica subsp. diarizonae serovar Rough:-:- tRNA-Leu
    3744. Salmonella enterica subsp. diarizonae str. CFSAN000553 tRNA-Leu
    3745. Salmonella enterica subsp. diarizonae str. CFSAN000558 tRNA-Leu
    3746. Salmonella enterica subsp. diarizonae tRNA-Leu(tag)
    3747. Salmonella enterica subsp. enterica serovar 1,3,19:g,m,t:- tRNA-Leu
    3748. Salmonella enterica subsp. enterica serovar 13,23:b:- tRNA-Leu
    3749. Salmonella enterica subsp. enterica serovar 13,23:i:- tRNA-Leu
    3750. Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- tRNA-Leu
    3751. Salmonella enterica subsp. enterica serovar 16:b:- tRNA-Leu
    3752. Salmonella enterica subsp. enterica serovar 1,9,12:-:- tRNA-Leu
    3753. Salmonella enterica subsp. enterica serovar 3,10:e,h:- tRNA-Leu
    3754. Salmonella enterica subsp. enterica serovar 4,12:d:- tRNA-Leu
    3755. Salmonella enterica subsp. enterica serovar 4,12:i:- tRNA-Leu
    3756. Salmonella enterica subsp. enterica serovar 4:-:1,2 tRNA-Leu
    3757. Salmonella enterica subsp. enterica serovar 44:z10:1,7 tRNA-Leu
    3758. Salmonella enterica subsp. enterica serovar 4,5,12,27:- tRNA-Leu
    3759. Salmonella enterica subsp. enterica serovar 4,[5],12:b:- tRNA-Leu
    3760. Salmonella enterica subsp. enterica serovar 4,5,12:b:- tRNA-Leu
    3761. Salmonella enterica subsp. enterica serovar 4,[5],12:d:- tRNA-Leu
    3762. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1700 tRNA-Leu
    3763. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3764. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1739 tRNA-Leu
    3765. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- tRNA-Leu
    3766. Salmonella enterica subsp. enterica serovar 4,5,12:i tRNA-Leu
    3767. Salmonella enterica subsp. enterica serovar 4,5,12:i- tRNA-Leu
    3768. Salmonella enterica subsp. enterica serovar 4,[5],12:r:- tRNA-Leu
    3769. Salmonella enterica subsp. enterica serovar [5],12,[27]:d:- tRNA-Leu
    3770. Salmonella enterica subsp. enterica serovar 51:z:1,5 tRNA-Leu
    3771. Salmonella enterica subsp. enterica serovar 6,7,14:g,m[p],s:[1,2,7] tRNA-Leu
    3772. Salmonella enterica subsp. enterica serovar 6,7,[14]:r:- tRNA-Leu
    3773. Salmonella enterica subsp. enterica serovar 6,7:-:1,5 tRNA-Leu
    3774. Salmonella enterica subsp. enterica serovar 6,7:-1,5 tRNA-Leu
    3775. Salmonella enterica subsp. enterica serovar 6,7:b:- tRNA-Leu
    3776. Salmonella enterica subsp. enterica serovar 6,7:c:1,5 tRNA-Leu
    3777. Salmonella enterica subsp. enterica serovar 6,7:e,h:- tRNA-Leu
    3778. Salmonella enterica subsp. enterica serovar 6,7:k:- tRNA-Leu
    3779. Salmonella enterica subsp. enterica serovar 6,7:l,v:- tRNA-Leu
    3780. Salmonella enterica subsp. enterica serovar 6,7:-:- tRNA-Leu
    3781. Salmonella enterica subsp. enterica serovar 6,8:-:1,2 tRNA-Leu
    3782. Salmonella enterica subsp. enterica serovar 6,8,20:d- tRNA-Leu
    3783. Salmonella enterica subsp. enterica serovar 6,8:d:- tRNA-Leu
    3784. Salmonella enterica subsp. enterica serovar 6,8:i:- tRNA-Leu
    3785. Salmonella enterica subsp. enterica serovar 7:d:z35 tRNA-Leu
    3786. Salmonella enterica subsp. enterica serovar 8,(20):i:- tRNA-Leu
    3787. Salmonella enterica subsp. enterica serovar 8,(20):-:z6 tRNA-Leu
    3788. Salmonella enterica subsp. enterica serovar 9,12:-:1,5 tRNA-Leu
    3789. Salmonella enterica subsp. enterica serovar 9,12:l,v:- str. 94293 tRNA-Leu
    3790. Salmonella enterica subsp. enterica serovar 9,12:l,z28:- tRNA-Leu
    3791. Salmonella enterica subsp. enterica serovar 9,12:- tRNA-Leu
    3792. Salmonella enterica subsp. enterica serovar 9,12:-:- tRNA-Leu
    3793. Salmonella enterica subsp. enterica serovar Abaetetuba str. ATCC 35640 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3794. Salmonella enterica subsp. enterica serovar Abaetetuba tRNA-Leu
    3795. Salmonella enterica subsp. enterica serovar Aba tRNA-Leu
    3796. Salmonella enterica subsp. enterica serovar Aberdeen tRNA-Leu(tag)
    3797. Salmonella enterica subsp. enterica serovar Abony str. 0014 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3798. Salmonella enterica subsp. enterica serovar Abony tRNA-Leu
    3799. Salmonella enterica subsp. enterica serovar Abortusequi tRNA-Leu
    3800. Salmonella enterica subsp. enterica serovar Abortusovis tRNA-Leu
    3801. Salmonella enterica subsp. enterica serovar Adamstua tRNA-Leu
    3802. Salmonella enterica subsp. enterica serovar Adelaide str. A4-669 tRNA-Leu
    3803. Salmonella enterica subsp. enterica serovar Adelaide tRNA-Leu
    3804. Salmonella enterica subsp. enterica serovar Adjame tRNA-Leu
    3805. Salmonella enterica subsp. enterica serovar Agama tRNA-Leu
    3806. Salmonella enterica subsp. enterica serovar Agbeni tRNA-Leu
    3807. Salmonella enterica subsp. enterica serovar Agona str. 0292 tRNA-Leu
    3808. Salmonella enterica subsp. enterica serovar Agona str. 241981 tRNA-Leu
    3809. Salmonella enterica subsp. enterica serovar Agona str. 24249 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3810. Salmonella enterica subsp. enterica serovar Agona str. 246555-3 tRNA-Leu
    3811. Salmonella enterica subsp. enterica serovar Agona str. 266757-1 tRNA-Leu
    3812. Salmonella enterica subsp. enterica serovar Agona str. 311387-1 tRNA-Leu
    3813. Salmonella enterica subsp. enterica serovar Agona str. 339787 tRNA-Leu
    3814. Salmonella enterica subsp. enterica serovar Agona str. 392869-1 tRNA-Leu
    3815. Salmonella enterica subsp. enterica serovar Agona str. 392869-2 tRNA-Leu
    3816. Salmonella enterica subsp. enterica serovar Agona str. 400095 11 tRNA-Leu
    3817. Salmonella enterica subsp. enterica serovar Agona str. 400095 13 tRNA-Leu
    3818. Salmonella enterica subsp. enterica serovar Agona str. 400095 14 tRNA-Leu
    3819. Salmonella enterica subsp. enterica serovar Agona str. 400095 17 tRNA-Leu
    3820. Salmonella enterica subsp. enterica serovar Agona str. 400095 18 tRNA-Leu
    3821. Salmonella enterica subsp. enterica serovar Agona str. 400095 19 tRNA-Leu
    3822. Salmonella enterica subsp. enterica serovar Agona str. 400095 22 tRNA-Leu
    3823. Salmonella enterica subsp. enterica serovar Agona str. 400096 16 tRNA-Leu
    3824. Salmonella enterica subsp. enterica serovar Agona str. 409753-6 tRNA-Leu
    3825. Salmonella enterica subsp. enterica serovar Agona str. 419639 2-1 tRNA-Leu
    3826. Salmonella enterica subsp. enterica serovar Agona str. 432613 tRNA-Leu
    3827. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-4 tRNA-Leu
    3828. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-5 tRNA-Leu
    3829. Salmonella enterica subsp. enterica serovar Agona str. 447967 1-1 tRNA-Leu
    3830. Salmonella enterica subsp. enterica serovar Agona str. 447967 2-1 tRNA-Leu
    3831. Salmonella enterica subsp. enterica serovar Agona str. 460004 1-1 tRNA-Leu
    3832. Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3833. Salmonella enterica subsp. enterica serovar Agona str. 467481 tRNA-Leu
    3834. Salmonella enterica subsp. enterica serovar Agona str. 557928 tRNA-Leu
    3835. Salmonella enterica subsp. enterica serovar Agona str. 620239 tRNA-Leu
    3836. Salmonella enterica subsp. enterica serovar Agona str. 632182-2 tRNA-Leu
    3837. Salmonella enterica subsp. enterica serovar Agona str. 648586-1 tRNA-Leu
    3838. Salmonella enterica subsp. enterica serovar Agona str. ATCC 51957 tRNA-Leu
    3839. Salmonella enterica subsp. enterica serovar Agona str. SA-1 tRNA-Leu
    3840. Salmonella enterica subsp. enterica serovar Agona str. SA-2 tRNA-Leu
    3841. Salmonella enterica subsp. enterica serovar Agona str. SA-3 tRNA-Leu
    3842. Salmonella enterica subsp. enterica serovar Agona str. SA-4 tRNA-Leu
    3843. Salmonella enterica subsp. enterica serovar Agona str. SA-5 tRNA-Leu
    3844. Salmonella enterica subsp. enterica serovar Agona str. SH08SF124 tRNA-Leu
    3845. Salmonella enterica subsp. enterica serovar Agona str. SH10GFN094 tRNA-Leu
    3846. Salmonella enterica subsp. enterica serovar Agona str. SH11G1113 tRNA-Leu
    3847. Salmonella enterica subsp. enterica serovar Agona str. SL483 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3848. Salmonella enterica subsp. enterica serovar Agona tRNA-Leu
    3849. Salmonella enterica subsp. enterica serovar Ago tRNA-Leu
    3850. Salmonella enterica subsp. enterica serovar Agoueve tRNA-Leu
    3851. Salmonella enterica subsp. enterica serovar Ajiobo tRNA-Leu
    3852. Salmonella enterica subsp. enterica serovar Akanji tRNA-Leu
    3853. Salmonella enterica subsp. enterica serovar Alabama tRNA-Leu
    3854. Salmonella enterica subsp. enterica serovar Alachua str. R6-377 tRNA-Leu
    3855. Salmonella enterica subsp. enterica serovar Alachua tRNA-Leu
    3856. Salmonella enterica subsp. enterica serovar Albany str. ATCC 51960 tRNA-Leu
    3857. Salmonella enterica subsp. enterica serovar Albany tRNA-Leu
    3858. Salmonella enterica subsp. enterica serovar Albert tRNA-Leu
    3859. Salmonella enterica subsp. enterica serovar Altendorf tRNA-Leu
    3860. Salmonella enterica subsp. enterica serovar Altona tRNA-Leu
    3861. Salmonella enterica subsp. enterica serovar Amager tRNA-Leu
    3862. Salmonella enterica subsp. enterica serovar Amersfoort tRNA-Leu
    3863. Salmonella enterica subsp. enterica serovar Amsterdam tRNA-Leu
    3864. Salmonella enterica subsp. enterica serovar Amsterdam var. 15+,34+ tRNA-Leu
    3865. Salmonella enterica subsp. enterica serovar Anatum str. ATCC BAA-1592 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3866. Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3867. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN000511 tRNA-Leu
    3868. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 tRNA-Leu
    3869. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003962 tRNA-Leu
    3870. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003963 tRNA-Leu
    3871. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003964 tRNA-Leu
    3872. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003967 tRNA-Leu
    3873. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003970 tRNA-Leu
    3874. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003971 tRNA-Leu
    3875. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003972 tRNA-Leu
    3876. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003973 tRNA-Leu
    3877. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003975 tRNA-Leu
    3878. Salmonella enterica subsp. enterica serovar Anatum str. USDA 100 tRNA-Leu
    3879. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3880. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 tRNA-Leu
    3881. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 tRNA-Leu
    3882. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 tRNA-Leu
    3883. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 tRNA-Leu
    3884. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 tRNA-Leu
    3885. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 tRNA-Leu
    3886. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 tRNA-Leu
    3887. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 tRNA-Leu
    3888. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 tRNA-Leu
    3889. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 tRNA-Leu
    3890. Salmonella enterica subsp. enterica serovar Anatum tRNA-Leu
    3891. Salmonella enterica subsp. enterica serovar Anatum var. 15+ tRNA-Leu
    3892. Salmonella enterica subsp. enterica serovar Anderlecht tRNA-Leu
    3893. Salmonella enterica subsp. enterica serovar Anecho tRNA-Leu
    3894. Salmonella enterica subsp. enterica serovar Anfo tRNA-Leu
    3895. Salmonella enterica subsp. enterica serovar Angoda tRNA-Leu
    3896. Salmonella enterica subsp. enterica serovar Ank tRNA-Leu
    3897. Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 tRNA-Leu
    3898. Salmonella enterica subsp. enterica serovar Antsalova tRNA-Leu
    3899. Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 tRNA-Leu
    3900. Salmonella enterica subsp. enterica serovar Apapa tRNA-Leu
    3901. Salmonella enterica subsp. enterica serovar Apeyeme tRNA-Leu
    3902. Salmonella enterica subsp. enterica serovar Aqua str. NVSL2001 tRNA-Leu
    3903. Salmonella enterica subsp. enterica serovar Arechavaleta tRNA-Leu
    3904. Salmonella enterica subsp. enterica serovar Arkansas tRNA-Leu
    3905. Salmonella enterica subsp. enterica serovar Aschersleben tRNA-Leu
    3906. Salmonella enterica subsp. enterica serovar Augustenborg tRNA-Leu
    3907. Salmonella enterica subsp. enterica serovar Austin tRNA-Leu
    3908. Salmonella enterica subsp. enterica serovar Baguida tRNA-Leu
    3909. Salmonella enterica subsp. enterica serovar Bahati tRNA-Leu
    3910. Salmonella enterica subsp. enterica serovar Bahrenfeld tRNA-Leu
    3911. Salmonella enterica subsp. enterica serovar Baildon str. R6-199 tRNA-Leu
    3912. Salmonella enterica subsp. enterica serovar Baildon tRNA-Leu
    3913. Salmonella enterica subsp. enterica serovar Bakau tRNA-Leu
    3914. Salmonella enterica subsp. enterica serovar Ball tRNA-Leu
    3915. Salmonella enterica subsp. enterica serovar Banana tRNA-Leu
    3916. Salmonella enterica subsp. enterica serovar Bardo tRNA-Leu
    3917. Salmonella enterica subsp. enterica serovar Bareilly str. 2780 tRNA-Leu
    3918. Salmonella enterica subsp. enterica serovar Bareilly str. ATCC 9115 tRNA-Leu
    3919. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000178 tRNA-Leu
    3920. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000179 tRNA-Leu
    3921. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000180 tRNA-Leu
    3922. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000181 tRNA-Leu
    3923. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000182 tRNA-Leu
    3924. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000183 tRNA-Leu
    3925. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000184 tRNA-Leu
    3926. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000185 tRNA-Leu
    3927. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000186 tRNA-Leu
    3928. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000187 tRNA-Leu
    3929. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000188 tRNA-Leu
    3930. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000189 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    3931. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000190 tRNA-Leu
    3932. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000191 tRNA-Leu
    3933. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000192 tRNA-Leu
    3934. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000193 tRNA-Leu
    3935. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000194 tRNA-Leu
    3936. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000195 tRNA-Leu
    3937. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000196 tRNA-Leu
    3938. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000197 tRNA-Leu
    3939. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000198 tRNA-Leu
    3940. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000199 tRNA-Leu
    3941. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000200 tRNA-Leu
    3942. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000201 tRNA-Leu
    3943. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000202 tRNA-Leu
    3944. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000203 tRNA-Leu
    3945. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000204 tRNA-Leu
    3946. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000205 tRNA-Leu
    3947. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000206 tRNA-Leu
    3948. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000207 tRNA-Leu
    3949. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000208 tRNA-Leu
    3950. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000209 tRNA-Leu
    3951. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000210 tRNA-Leu
    3952. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000211 tRNA-Leu
    3953. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000212 tRNA-Leu
    3954. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000213 tRNA-Leu
    3955. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000214 tRNA-Leu
    3956. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000215 tRNA-Leu
    3957. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000216 tRNA-Leu
    3958. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000217 tRNA-Leu
    3959. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000218 tRNA-Leu
    3960. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000219 tRNA-Leu
    3961. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000220 tRNA-Leu
    3962. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000221 tRNA-Leu
    3963. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000222 tRNA-Leu
    3964. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000223 tRNA-Leu
    3965. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000224 tRNA-Leu
    3966. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000225 tRNA-Leu
    3967. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000226 tRNA-Leu
    3968. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000227 tRNA-Leu
    3969. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000228 tRNA-Leu
    3970. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000229 tRNA-Leu
    3971. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000230 tRNA-Leu
    3972. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000231 tRNA-Leu
    3973. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000232 tRNA-Leu
    3974. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000233 tRNA-Leu
    3975. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000235 tRNA-Leu
    3976. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000236 tRNA-Leu
    3977. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000661 tRNA-Leu
    3978. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000662 tRNA-Leu
    3979. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 tRNA-Leu
    3980. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000680 tRNA-Leu
    3981. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000700 tRNA-Leu
    3982. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 tRNA-Leu
    3983. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000753 tRNA-Leu
    3984. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000754 tRNA-Leu
    3985. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000755 tRNA-Leu
    3986. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000951 tRNA-Leu
    3987. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000952 tRNA-Leu
    3988. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000953 tRNA-Leu
    3989. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000954 tRNA-Leu
    3990. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000955 tRNA-Leu
    3991. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000956 tRNA-Leu
    3992. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000957 tRNA-Leu
    3993. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000958 tRNA-Leu
    3994. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000959 tRNA-Leu
    3995. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000960 tRNA-Leu
    3996. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000961 tRNA-Leu
    3997. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000962 tRNA-Leu
    3998. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000963 tRNA-Leu
    3999. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000964 tRNA-Leu
    4000. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000965 tRNA-Leu
    4001. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000966 tRNA-Leu
    4002. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000967 tRNA-Leu
    4003. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 tRNA-Leu
    4004. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000969 tRNA-Leu
    4005. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000970 tRNA-Leu
    4006. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001087 tRNA-Leu
    4007. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001088 tRNA-Leu
    4008. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001089 tRNA-Leu
    4009. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001090 tRNA-Leu
    4010. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001099 tRNA-Leu
    4011. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001102 tRNA-Leu
    4012. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001105 tRNA-Leu
    4013. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001107 tRNA-Leu
    4014. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001108 tRNA-Leu
    4015. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001109 tRNA-Leu
    4016. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001111 tRNA-Leu
    4017. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001112 tRNA-Leu
    4018. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001114 tRNA-Leu
    4019. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001115 tRNA-Leu
    4020. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001117 tRNA-Leu
    4021. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001118 tRNA-Leu
    4022. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001140 tRNA-Leu
    4023. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001591 tRNA-Leu
    4024. Salmonella enterica subsp. enterica serovar Bareilly tRNA-Leu
    4025. Salmonella enterica subsp. enterica serovar Barranquilla tRNA-Leu
    4026. Salmonella enterica subsp. enterica serovar Beaudesert tRNA-Leu
    4027. Salmonella enterica subsp. enterica serovar Benin tRNA-Leu
    4028. Salmonella enterica subsp. enterica serovar Bere tRNA-Leu
    4029. Salmonella enterica subsp. enterica serovar Bergen str. ST350 tRNA-Leu
    4030. Salmonella enterica subsp. enterica serovar Bergen tRNA-Leu
    4031. Salmonella enterica subsp. enterica serovar Berkeley tRNA-Leu
    4032. Salmonella enterica subsp. enterica serovar Berlin tRNA-Leu
    4033. Salmonella enterica subsp. enterica serovar Berta str. ATCC 8392 tRNA-Leu
    4034. Salmonella enterica subsp. enterica serovar Berta str. SA20103550 tRNA-Leu
    4035. Salmonella enterica subsp. enterica serovar Berta tRNA-Leu
    4036. Salmonella enterica subsp. enterica serovar Bietri tRNA-Leu
    4037. Salmonella enterica subsp. enterica serovar Bijlmer tRNA-Leu
    4038. Salmonella enterica subsp. enterica serovar Binza tRNA-Leu
    4039. Salmonella enterica subsp. enterica serovar Birkenhead tRNA-Leu
    4040. Salmonella enterica subsp. enterica serovar Bispebjerg tRNA-Leu
    4041. Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 tRNA-Leu
    4042. Salmonella enterica subsp. enterica serovar Blegdam tRNA-Leu
    4043. Salmonella enterica subsp. enterica serovar Blockley tRNA-Leu
    4044. Salmonella enterica subsp. enterica serovar Blukwa tRNA-Leu
    4045. Salmonella enterica subsp. enterica serovar Bochum tRNA-Leu
    4046. Salmonella enterica subsp. enterica serovar Bonariensis tRNA-Leu
    4047. Salmonella enterica subsp. enterica serovar Bonn tRNA-Leu
    4048. Salmonella enterica subsp. enterica serovar Borreze str. SA20041063 tRNA-Leu
    4049. Salmonella enterica subsp. enterica serovar Bovismorbificans str. 3114 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4050. Salmonella enterica subsp. enterica serovar Bovismorbificans str. Sal610 tRNA-Leu
    4051. Salmonella enterica subsp. enterica serovar Bovismorbificans tRNA-Leu(tag)
    4052. Salmonella enterica subsp. enterica serovar Bracknell tRNA-Leu
    4053. Salmonella enterica subsp. enterica serovar Braenderup str. ATCC BAA-664 tRNA-Leu
    4054. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN000756 tRNA-Leu
    4055. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN001745 tRNA-Leu
    4056. Salmonella enterica subsp. enterica serovar Braenderup tRNA-Leu(tag)
    4057. Salmonella enterica subsp. enterica serovar Brancaster tRNA-Leu
    4058. Salmonella enterica subsp. enterica serovar Brandenburg tRNA-Leu
    4059. Salmonella enterica subsp. enterica serovar Brazzaville tRNA-Leu
    4060. Salmonella enterica subsp. enterica serovar Breda tRNA-Leu
    4061. Salmonella enterica subsp. enterica serovar Bredeney str. CFSAN001080 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4062. Salmonella enterica subsp. enterica serovar Bredeney tRNA-Leu(tag)
    4063. Salmonella enterica subsp. enterica serovar Brevik tRNA-Leu
    4064. Salmonella enterica subsp. enterica serovar Brijbhumi tRNA-Leu
    4065. Salmonella enterica subsp. enterica serovar Bristol tRNA-Leu
    4066. Salmonella enterica subsp. enterica serovar Bron tRNA-Leu
    4067. Salmonella enterica subsp. enterica serovar Brunei tRNA-Leu
    4068. Salmonella enterica subsp. enterica serovar Buckeye tRNA-Leu
    4069. Salmonella enterica subsp. enterica serovar Bukavu tRNA-Leu
    4070. Salmonella enterica subsp. enterica serovar Butantan tRNA-Leu
    4071. Salmonella enterica subsp. enterica serovar Buzu tRNA-Leu
    4072. Salmonella enterica subsp. enterica serovar Cairina tRNA-Leu
    4073. Salmonella enterica subsp. enterica serovar Calabar tRNA-Leu
    4074. Salmonella enterica subsp. enterica serovar California tRNA-Leu
    4075. Salmonella enterica subsp. enterica serovar Canada tRNA-Leu
    4076. Salmonella enterica subsp. enterica serovar Cannstatt tRNA-Leu
    4077. Salmonella enterica subsp. enterica serovar Caracas tRNA-Leu
    4078. Salmonella enterica subsp. enterica serovar Cardoner tRNA-Leu
    4079. Salmonella enterica subsp. enterica serovar Carmel tRNA-Leu
    4080. Salmonella enterica subsp. enterica serovar Carno tRNA-Leu
    4081. Salmonella enterica subsp. enterica serovar Carrau tRNA-Leu
    4082. Salmonella enterica subsp. enterica serovar Cerro str. FSL R8-0235 tRNA-Leu
    4083. Salmonella enterica subsp. enterica serovar Cerro str. 818 tRNA-Leu
    4084. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001587 tRNA-Leu
    4085. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 tRNA-Leu
    4086. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001589 tRNA-Leu
    4087. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001590 tRNA-Leu
    4088. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001669 tRNA-Leu
    4089. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001670 tRNA-Leu
    4090. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001671 tRNA-Leu
    4091. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001673 tRNA-Leu
    4092. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001674 tRNA-Leu
    4093. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001679 tRNA-Leu
    4094. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001681 tRNA-Leu
    4095. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001690 tRNA-Leu
    4096. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001691 tRNA-Leu
    4097. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001692 tRNA-Leu
    4098. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001697 tRNA-Leu
    4099. Salmonella enterica subsp. enterica serovar Cerro tRNA-Leu
    4100. Salmonella enterica subsp. enterica serovar Ceyco tRNA-Leu
    4101. Salmonella enterica subsp. enterica serovar Chailey tRNA-Leu
    4102. Salmonella enterica subsp. enterica serovar Champaign tRNA-Leu
    4103. Salmonella enterica subsp. enterica serovar Chandans tRNA-Leu
    4104. Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 tRNA-Leu
    4105. Salmonella enterica subsp. enterica serovar Chester tRNA-Leu
    4106. Salmonella enterica subsp. enterica serovar Chicago tRNA-Leu
    4107. Salmonella enterica subsp. enterica serovar Chincol tRNA-Leu
    4108. Salmonella enterica subsp. enterica serovar Chittagong tRNA-Leu
    4109. Salmonella enterica subsp. enterica serovar Choleraesuis str. 0006 tRNA-Leu
    4110. Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708 tRNA-Leu
    4111. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000514 tRNA-Leu
    4112. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000515 tRNA-Leu
    4113. Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4114. Salmonella enterica subsp. enterica serovar Choleraesuis str. SCSA50 tRNA-Leu
    4115. Salmonella enterica subsp. enterica serovar Choleraesuis tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4116. Salmonella enterica subsp. enterica serovar Chomedey tRNA-Leu
    4117. Salmonella enterica subsp. enterica serovar Clackamas tRNA-Leu
    4118. Salmonella enterica subsp. enterica serovar Claibornei tRNA-Leu
    4119. Salmonella enterica subsp. enterica serovar Coeln tRNA-Leu
    4120. Salmonella enterica subsp. enterica serovar Coleypark tRNA-Leu
    4121. Salmonella enterica subsp. enterica serovar Colindale tRNA-Leu
    4122. Salmonella enterica subsp. enterica serovar Concord tRNA-Leu
    4123. Salmonella enterica subsp. enterica serovar Copenhagen tRNA-Leu
    4124. Salmonella enterica subsp. enterica serovar Coquilhatville tRNA-Leu
    4125. Salmonella enterica subsp. enterica serovar Corvallis tRNA-Leu
    4126. Salmonella enterica subsp. enterica serovar Cotham tRNA-Leu
    4127. Salmonella enterica subsp. enterica serovar Cremieu tRNA-Leu
    4128. Salmonella enterica subsp. enterica serovar Crossness str. 1422-74 tRNA-Leu
    4129. Salmonella enterica subsp. enterica serovar Cubana str. CFSAN001083 tRNA-Leu
    4130. Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4131. Salmonella enterica subsp. enterica serovar Cubana str. CVM42234 tRNA-Leu
    4132. Salmonella enterica subsp. enterica serovar Cubana tRNA-Leu
    4133. Salmonella enterica subsp. enterica serovar Cullingworth tRNA-Leu
    4134. Salmonella enterica subsp. enterica serovar Curacao tRNA-Leu
    4135. Salmonella enterica subsp. enterica serovar Dabou tRNA-Leu
    4136. Salmonella enterica subsp. enterica serovar Daytona tRNA-Leu(tag)
    4137. Salmonella enterica subsp. enterica serovar Decatur tRNA-Leu
    4138. Salmonella enterica subsp. enterica serovar Denver tRNA-Leu
    4139. Salmonella enterica subsp. enterica serovar Derby str. 626 tRNA-Leu
    4140. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000564 tRNA-Leu
    4141. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000565 tRNA-Leu
    4142. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000566 tRNA-Leu
    4143. Salmonella enterica subsp. enterica serovar Derby tRNA-Leu(tag)
    4144. Salmonella enterica subsp. enterica serovar Dessau tRNA-Leu
    4145. Salmonella enterica subsp. enterica serovar Diguel tRNA-Leu
    4146. Salmonella enterica subsp. enterica serovar Djakarta str. S-1087 tRNA-Leu
    4147. Salmonella enterica subsp. enterica serovar Djugu tRNA-Leu
    4148. Salmonella enterica subsp. enterica serovar Dortmund tRNA-Leu
    4149. Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 tRNA-Leu
    4150. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000518 tRNA-Leu
    4151. Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4152. Salmonella enterica subsp. enterica serovar Dublin str. DG22 tRNA-Leu
    4153. Salmonella enterica subsp. enterica serovar Dublin str. SA20093032 tRNA-Leu
    4154. Salmonella enterica subsp. enterica serovar Dublin str. SD3246 tRNA-Leu
    4155. Salmonella enterica subsp. enterica serovar Dublin str. SL1438 tRNA-Leu
    4156. Salmonella enterica subsp. enterica serovar Dublin str. UC16 tRNA-Leu
    4157. Salmonella enterica subsp. enterica serovar Dublin tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4158. Salmonella enterica subsp. enterica serovar Duesseldorf tRNA-Leu
    4159. Salmonella enterica subsp. enterica serovar Dugbe tRNA-Leu
    4160. Salmonella enterica subsp. enterica serovar Duisburg tRNA-Leu
    4161. Salmonella enterica subsp. enterica serovar Durban tRNA-Leu
    4162. Salmonella enterica subsp. enterica serovar Durham tRNA-Leu
    4163. Salmonella enterica subsp. enterica serovar Ealing tRNA-Leu
    4164. Salmonella enterica subsp. enterica serovar Eastbourne str. CFSAN001084 tRNA-Leu
    4165. Salmonella enterica subsp. enterica serovar Eastbourne tRNA-Leu
    4166. Salmonella enterica subsp. enterica serovar Eboko tRNA-Leu
    4167. Salmonella enterica subsp. enterica serovar Ekotedo tRNA-Leu
    4168. Salmonella enterica subsp. enterica serovar Eko tRNA-Leu
    4169. Salmonella enterica subsp. enterica serovar Elisabethville tRNA-Leu
    4170. Salmonella enterica subsp. enterica serovar Elomrane tRNA-Leu
    4171. Salmonella enterica subsp. enterica serovar Emek tRNA-Leu
    4172. Salmonella enterica subsp. enterica serovar Enteritidis str. 08-1080 tRNA-Leu
    4173. Salmonella enterica subsp. enterica serovar Enteritidis str. 10-34587 tRNA-Leu
    4174. Salmonella enterica subsp. enterica serovar Enteritidis str. 13183-1 tRNA-Leu
    4175. Salmonella enterica subsp. enterica serovar Enteritidis str. 13-1 tRNA-Leu
    4176. Salmonella enterica subsp. enterica serovar Enteritidis str. 17927 tRNA-Leu
    4177. Salmonella enterica subsp. enterica serovar Enteritidis str. 18569 tRNA-Leu
    4178. Salmonella enterica subsp. enterica serovar Enteritidis str. 20037 tRNA-Leu
    4179. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K0958 tRNA-Leu
    4180. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K1651 tRNA-Leu
    4181. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K1726 tRNA-Leu
    4182. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0267 tRNA-Leu
    4183. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0286 tRNA-Leu
    4184. Salmonella enterica subsp. enterica serovar Enteritidis str. 22558 tRNA-Leu
    4185. Salmonella enterica subsp. enterica serovar Enteritidis str. 22704 tRNA-Leu
    4186. Salmonella enterica subsp. enterica serovar Enteritidis str. 33944 tRNA-Leu
    4187. Salmonella enterica subsp. enterica serovar Enteritidis str. 3402 tRNA-Leu
    4188. Salmonella enterica subsp. enterica serovar Enteritidis str. 436 tRNA-Leu
    4189. Salmonella enterica subsp. enterica serovar Enteritidis str. 485549-17 tRNA-Leu
    4190. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-3079 tRNA-Leu
    4191. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-5646 tRNA-Leu
    4192. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 22-17 tRNA-Leu
    4193. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 40-18 tRNA-Leu
    4194. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 42-20 tRNA-Leu
    4195. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 1-1 tRNA-Leu
    4196. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 9-7 tRNA-Leu
    4197. Salmonella enterica subsp. enterica serovar Enteritidis str. 576709 tRNA-Leu
    4198. Salmonella enterica subsp. enterica serovar Enteritidis str. 58-6482 tRNA-Leu
    4199. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-22 tRNA-Leu
    4200. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-70 tRNA-Leu
    4201. Salmonella enterica subsp. enterica serovar Enteritidis str. 6.0562-1 tRNA-Leu
    4202. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-2 tRNA-Leu
    4203. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-6 tRNA-Leu
    4204. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-16 tRNA-Leu
    4205. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-19 tRNA-Leu
    4206. Salmonella enterica subsp. enterica serovar Enteritidis str. 62-1976 tRNA-Leu
    4207. Salmonella enterica subsp. enterica serovar Enteritidis str. 622731-39 tRNA-Leu
    4208. Salmonella enterica subsp. enterica serovar Enteritidis str. 629163 tRNA-Leu
    4209. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-26 tRNA-Leu
    4210. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-37 tRNA-Leu
    4211. Salmonella enterica subsp. enterica serovar Enteritidis str. 635290-58 tRNA-Leu
    4212. Salmonella enterica subsp. enterica serovar Enteritidis str. 638970-15 tRNA-Leu
    4213. Salmonella enterica subsp. enterica serovar Enteritidis str. 639016-6 tRNA-Leu
    4214. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-46 tRNA-Leu
    4215. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-50 tRNA-Leu
    4216. Salmonella enterica subsp. enterica serovar Enteritidis str. 640631 tRNA-Leu
    4217. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 4-1 tRNA-Leu
    4218. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 8-1 tRNA-Leu
    4219. Salmonella enterica subsp. enterica serovar Enteritidis str. 642046 4-7 tRNA-Leu
    4220. Salmonella enterica subsp. enterica serovar Enteritidis str. 648898 4-5 tRNA-Leu
    4221. Salmonella enterica subsp. enterica serovar Enteritidis str. 648899 3-17 tRNA-Leu
    4222. Salmonella enterica subsp. enterica serovar Enteritidis str. 648900 1-16 tRNA-Leu
    4223. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 1-17 tRNA-Leu
    4224. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 16-16 tRNA-Leu
    4225. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 39-2 tRNA-Leu
    4226. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 6-18 tRNA-Leu
    4227. Salmonella enterica subsp. enterica serovar Enteritidis str. 648902 6-8 tRNA-Leu
    4228. Salmonella enterica subsp. enterica serovar Enteritidis str. 648903 1-6 tRNA-Leu
    4229. Salmonella enterica subsp. enterica serovar Enteritidis str. 648904 3-6 tRNA-Leu
    4230. Salmonella enterica subsp. enterica serovar Enteritidis str. 648905 5-18 tRNA-Leu
    4231. Salmonella enterica subsp. enterica serovar Enteritidis str. 653049 13-19 tRNA-Leu
    4232. Salmonella enterica subsp. enterica serovar Enteritidis str. 76-2651 tRNA-Leu
    4233. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-0424 tRNA-Leu
    4234. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4235. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-2659 tRNA-Leu
    4236. Salmonella enterica subsp. enterica serovar Enteritidis str. 78-1757 tRNA-Leu
    4237. Salmonella enterica subsp. enterica serovar Enteritidis str. 81-2625 tRNA-Leu
    4238. Salmonella enterica subsp. enterica serovar Enteritidis str. 8b-1 tRNA-Leu
    4239. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0895 tRNA-Leu
    4240. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0899 tRNA-Leu
    4241. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0956 tRNA-Leu
    4242. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4243. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1010 tRNA-Leu
    4244. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1018 tRNA-Leu
    4245. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1441 tRNA-Leu
    4246. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1444 tRNA-Leu
    4247. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1445 tRNA-Leu
    4248. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1455 tRNA-Leu
    4249. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1457 tRNA-Leu
    4250. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1543 tRNA-Leu
    4251. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1558 tRNA-Leu
    4252. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1559 tRNA-Leu
    4253. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1566 tRNA-Leu
    4254. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1575 tRNA-Leu
    4255. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1580 tRNA-Leu
    4256. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1594 tRNA-Leu
    4257. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1725 tRNA-Leu
    4258. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1729 tRNA-Leu
    4259. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1745 tRNA-Leu
    4260. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1747 tRNA-Leu
    4261. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1791 tRNA-Leu
    4262. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1795 tRNA-Leu
    4263. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1808 tRNA-Leu
    4264. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1810 tRNA-Leu
    4265. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1811 tRNA-Leu
    4266. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1882 tRNA-Leu
    4267. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1884 tRNA-Leu
    4268. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000052 tRNA-Leu
    4269. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000568 tRNA-Leu
    4270. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS44 tRNA-Leu
    4271. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS4 tRNA-Leu
    4272. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_56-3991 tRNA-Leu
    4273. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_69-4941 tRNA-Leu
    4274. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_76-3618 tRNA-Leu
    4275. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_81-2490 tRNA-Leu
    4276. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_N202 tRNA-Leu
    4277. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090135 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4278. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090193 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4279. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090195 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4280. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090332 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4281. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090530 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4282. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090531 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4283. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090641 tRNA-Leu
    4284. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090884 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4285. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100088 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4286. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100089 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4287. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100100 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4288. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100101 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4289. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100103 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4290. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100130 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4291. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100131 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4292. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100134 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4293. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100325 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4294. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110221 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4295. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110222 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4296. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110223 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4297. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110354 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4298. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110355 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4299. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110356 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4300. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110359 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4301. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110360 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4302. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110361 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4303. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111095 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4304. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111174 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4305. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111175 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4306. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111510 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4307. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111514 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4308. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111515 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4309. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111554 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4310. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111561 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4311. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111576 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4312. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120002 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4313. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120003 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4314. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120005 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4315. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120007 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4316. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120008 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4317. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120009 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4318. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120051 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4319. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120200 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4320. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120213 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4321. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120219 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4322. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120229 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4323. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120240 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4324. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120356 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4325. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120469 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4326. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120496 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4327. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120497 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4328. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120498 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4329. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120505 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4330. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120528 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4331. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120544 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4332. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120548 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4333. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120555 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4334. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120580 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4335. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120581 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4336. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120590 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4337. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120597 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4338. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120677 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4339. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120685 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4340. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120686 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4341. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120687 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4342. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120697 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4343. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120722 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4344. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120734 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4345. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120738 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4346. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120765 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4347. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120773 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4348. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120774 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4349. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120775 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4350. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120776 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4351. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120916 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4352. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120917 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4353. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120918 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4354. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120925 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4355. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120927 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4356. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120929 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4357. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120963 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4358. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120968 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4359. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120969 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4360. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120970 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4361. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120994 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4362. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121004 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4363. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121175 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4364. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121176 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4365. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121177 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4366. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121178 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4367. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121179 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4368. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121180 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4369. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121541 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4370. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121542 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4371. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121671 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4372. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121672 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4373. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121689 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4374. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121744 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4375. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121746 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4376. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121747 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4377. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121748 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4378. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121750 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4379. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121751 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4380. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121753 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4381. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121765 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4382. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121812 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4383. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121825 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4384. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121826 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4385. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121969 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4386. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121970 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4387. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121976 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4388. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121986 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4389. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121989 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4390. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121990 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4391. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122022 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4392. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122026 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4393. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122031 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4394. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122033 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4395. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122045 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4396. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130345 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4397. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130346 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4398. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130347 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4399. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130348 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4400. Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4401. Salmonella enterica subsp. enterica serovar Enteritidis str. PT23 tRNA-Leu
    4402. Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 tRNA-Leu
    4403. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19930684 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4404. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19940857 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4405. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19942384 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4406. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19943269 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4407. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19960848 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4408. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19961622 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4409. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970510 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4410. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970769 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4411. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19971331 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4412. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19980677 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4413. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981522 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4414. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981857 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4415. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19982831 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4416. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19983126 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4417. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19992322 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4418. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19994216 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4419. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20082034 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4420. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083456 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4421. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083636 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4422. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084384 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4423. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084644 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4424. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084824 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4425. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20085285 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4426. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090419 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4427. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090435 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4428. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090877 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4429. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20091739 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4430. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20092320 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4431. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093266 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4432. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093421 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4433. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093430 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4434. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093538 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4435. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093543 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4436. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093784 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4437. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093788 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4438. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093950 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4439. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093977 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4440. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094079 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4441. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094177 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4442. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094301 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4443. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094350 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4444. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094352 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4445. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094383 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4446. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094389 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4447. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094521 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4448. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094642 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4449. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094682 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4450. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094803 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4451. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095309 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4452. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095440 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4453. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100239 tRNA-Leu
    4454. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100349 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4455. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20121703 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4456. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20123395 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4457. Salmonella enterica subsp. enterica serovar Enteritidis str. SARB17 tRNA-Leu
    4458. Salmonella enterica subsp. enterica serovar Enteritidis str. SE10 tRNA-Leu
    4459. Salmonella enterica subsp. enterica serovar Enteritidis str. SE15-1 tRNA-Leu
    4460. Salmonella enterica subsp. enterica serovar Enteritidis str. SE30663 tRNA-Leu
    4461. Salmonella enterica subsp. enterica serovar Enteritidis str. SE8a tRNA-Leu
    4462. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE001 tRNA-Leu
    4463. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE002 tRNA-Leu
    4464. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE003 tRNA-Leu
    4465. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE004 tRNA-Leu
    4466. Salmonella enterica subsp. enterica serovar Enteritidis str. SL909 tRNA-Leu
    4467. Salmonella enterica subsp. enterica serovar Enteritidis str. SL913 tRNA-Leu
    4468. Salmonella enterica subsp. enterica serovar Enteritidis tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4469. Salmonella enterica subsp. enterica serovar Enugu tRNA-Leu
    4470. Salmonella enterica subsp. enterica serovar Essen tRNA-Leu
    4471. Salmonella enterica subsp. enterica serovar Everleigh tRNA-Leu
    4472. Salmonella enterica subsp. enterica serovar Falkensee tRNA-Leu
    4473. Salmonella enterica subsp. enterica serovar Fallowfield tRNA-Leu
    4474. Salmonella enterica subsp. enterica serovar Fann tRNA-Leu
    4475. Salmonella enterica subsp. enterica serovar Fanti tRNA-Leu
    4476. Salmonella enterica subsp. enterica serovar Farmsen tRNA-Leu
    4477. Salmonella enterica subsp. enterica serovar Florian tRNA-Leu
    4478. Salmonella enterica subsp. enterica serovar Florida tRNA-Leu
    4479. Salmonella enterica subsp. enterica serovar Flottbek tRNA-Leu
    4480. Salmonella enterica subsp. enterica serovar Fluntern tRNA-Leu
    4481. Salmonella enterica subsp. enterica serovar Freetown tRNA-Leu
    4482. Salmonella enterica subsp. enterica serovar Fresno str. ST224 tRNA-Leu
    4483. Salmonella enterica subsp. enterica serovar Fresno tRNA-Leu
    4484. Salmonella enterica subsp. enterica serovar Frintrop tRNA-Leu
    4485. Salmonella enterica subsp. enterica serovar Fufu tRNA-Leu
    4486. Salmonella enterica subsp. enterica serovar Fulica tRNA-Leu
    4487. Salmonella enterica subsp. enterica serovar Gafsa tRNA-Leu
    4488. Salmonella enterica subsp. enterica serovar Galiema tRNA-Leu
    4489. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. CDC1983-67 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4490. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. FCAV198 tRNA-Leu
    4491. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. RKS5078 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4492. Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4493. Salmonella enterica subsp. enterica serovar Gallinarum str. 9184 tRNA-Leu
    4494. Salmonella enterica subsp. enterica serovar Gallinarum str. CFSAN000571 tRNA-Leu
    4495. Salmonella enterica subsp. enterica serovar Gallinarum str. SG9 tRNA-Leu
    4496. Salmonella enterica subsp. enterica serovar Gallinarum tRNA-Leu(tag)
    4497. Salmonella enterica subsp. enterica serovar Gambia tRNA-Leu
    4498. Salmonella enterica subsp. enterica serovar Gaminara str. A4-567 tRNA-Leu
    4499. Salmonella enterica subsp. enterica serovar Gaminara str. ATCC BAA-711 tRNA-Leu
    4500. Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 tRNA-Leu
    4501. Salmonella enterica subsp. enterica serovar Gaminara tRNA-Leu
    4502. Salmonella enterica subsp. enterica serovar Garoli tRNA-Leu
    4503. Salmonella enterica subsp. enterica serovar Gatow tRNA-Leu
    4504. Salmonella enterica subsp. enterica serovar Gatuni tRNA-Leu
    4505. Salmonella enterica subsp. enterica serovar Gdansk tRNA-Leu
    4506. Salmonella enterica subsp. enterica serovar Georgia tRNA-Leu
    4507. Salmonella enterica subsp. enterica serovar Geraldton tRNA-Leu
    4508. Salmonella enterica subsp. enterica serovar Giessen tRNA-Leu
    4509. Salmonella enterica subsp. enterica serovar Give str. 564 tRNA-Leu
    4510. Salmonella enterica subsp. enterica serovar Give str. S5-487 tRNA-Leu
    4511. Salmonella enterica subsp. enterica serovar Give tRNA-Leu(tag)
    4512. Salmonella enterica subsp. enterica serovar Give var. 15 str. CFSAN004343 tRNA-Leu
    4513. Salmonella enterica subsp. enterica serovar Glostrup tRNA-Leu
    4514. Salmonella enterica subsp. enterica serovar Godesberg tRNA-Leu
    4515. Salmonella enterica subsp. enterica serovar Gokul tRNA-Leu
    4516. Salmonella enterica subsp. enterica serovar Goldcoast tRNA-Leu(tag)
    4517. Salmonella enterica subsp. enterica serovar Gombe tRNA-Leu
    4518. Salmonella enterica subsp. enterica serovar Goverdhan tRNA-Leu
    4519. Salmonella enterica subsp. enterica serovar Grumpensis tRNA-Leu
    4520. Salmonella enterica subsp. enterica serovar Gueuletapee tRNA-Leu
    4521. Salmonella enterica subsp. enterica serovar Guildford tRNA-Leu
    4522. Salmonella enterica subsp. enterica serovar Guinea tRNA-Leu
    4523. Salmonella enterica subsp. enterica serovar Haardt tRNA-Leu
    4524. Salmonella enterica subsp. enterica serovar Hadar str. ATCC 51956 tRNA-Leu
    4525. Salmonella enterica subsp. enterica serovar Hadar str. SA20026260 tRNA-Leu
    4526. Salmonella enterica subsp. enterica serovar Hadar tRNA-Leu
    4527. Salmonella enterica subsp. enterica serovar Haduna tRNA-Leu
    4528. Salmonella enterica subsp. enterica serovar Haifa tRNA-Leu
    4529. Salmonella enterica subsp. enterica serovar Halle tRNA-Leu
    4530. Salmonella enterica subsp. enterica serovar Hartford str. CFSAN001075 tRNA-Leu
    4531. Salmonella enterica subsp. enterica serovar Hartford tRNA-Leu
    4532. Salmonella enterica subsp. enterica serovar Hato tRNA-Leu
    4533. Salmonella enterica subsp. enterica serovar Havana str. CFSAN001082 tRNA-Leu
    4534. Salmonella enterica subsp. enterica serovar Havana tRNA-Leu(tag)
    4535. Salmonella enterica subsp. enterica serovar Hayindogo tRNA-Leu
    4536. Salmonella enterica subsp. enterica serovar Heidelberg str. 21381 tRNA-Leu
    4537. Salmonella enterica subsp. enterica serovar Heidelberg str. 24390 tRNA-Leu
    4538. Salmonella enterica subsp. enterica serovar Heidelberg str. 24393 tRNA-Leu
    4539. Salmonella enterica subsp. enterica serovar Heidelberg str. 29169 tRNA-Leu
    4540. Salmonella enterica subsp. enterica serovar Heidelberg str. 32507 tRNA-Leu
    4541. Salmonella enterica subsp. enterica serovar Heidelberg str. 41563 tRNA-Leu
    4542. Salmonella enterica subsp. enterica serovar Heidelberg str. 41565 tRNA-Leu
    4543. Salmonella enterica subsp. enterica serovar Heidelberg str. 41566 tRNA-Leu
    4544. Salmonella enterica subsp. enterica serovar Heidelberg str. 41567 tRNA-Leu
    4545. Salmonella enterica subsp. enterica serovar Heidelberg str. 41573 tRNA-Leu
    4546. Salmonella enterica subsp. enterica serovar Heidelberg str. 41576 tRNA-Leu
    4547. Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4548. Salmonella enterica subsp. enterica serovar Heidelberg str. 41579 tRNA-Leu
    4549. Salmonella enterica subsp. enterica serovar Heidelberg str. 41584 tRNA-Leu
    4550. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-10 tRNA-Leu
    4551. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-19 tRNA-Leu
    4552. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-34 tRNA-Leu
    4553. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-5 tRNA-Leu
    4554. Salmonella enterica subsp. enterica serovar Heidelberg str. 607310-1 tRNA-Leu
    4555. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-11 tRNA-Leu
    4556. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-12 tRNA-Leu
    4557. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-14 tRNA-Leu
    4558. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-21 tRNA-Leu
    4559. Salmonella enterica subsp. enterica serovar Heidelberg str. 632675-24 tRNA-Leu
    4560. Salmonella enterica subsp. enterica serovar Heidelberg str. 640151-11 tRNA-Leu
    4561. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-3 tRNA-Leu
    4562. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-5 tRNA-Leu
    4563. Salmonella enterica subsp. enterica serovar Heidelberg str. 75-3547 tRNA-Leu
    4564. Salmonella enterica subsp. enterica serovar Heidelberg str. 76-0300 tRNA-Leu
    4565. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-1831 tRNA-Leu
    4566. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-2823 tRNA-Leu
    4567. Salmonella enterica subsp. enterica serovar Heidelberg str. 79-0480 tRNA-Leu
    4568. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-1617 tRNA-Leu
    4569. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-2052 tRNA-Leu
    4570. Salmonella enterica subsp. enterica serovar Heidelberg str. 83-1068 tRNA-Leu
    4571. Salmonella enterica subsp. enterica serovar Heidelberg str. 84-1004 tRNA-Leu
    4572. Salmonella enterica subsp. enterica serovar Heidelberg str. 85-0486 tRNA-Leu
    4573. Salmonella enterica subsp. enterica serovar Heidelberg str. 86-0255 tRNA-Leu
    4574. Salmonella enterica subsp. enterica serovar Heidelberg str. 87-0208 tRNA-Leu
    4575. Salmonella enterica subsp. enterica serovar Heidelberg str. 88-0312 tRNA-Leu
    4576. Salmonella enterica subsp. enterica serovar Heidelberg str. 89-0213 tRNA-Leu
    4577. Salmonella enterica subsp. enterica serovar Heidelberg str. 90-0318 tRNA-Leu
    4578. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0138 tRNA-Leu
    4579. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0144 tRNA-Leu
    4580. Salmonella enterica subsp. enterica serovar Heidelberg str. B182 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4581. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000577 tRNA-Leu
    4582. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000578 tRNA-Leu
    4583. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002056 tRNA-Leu
    4584. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002057 tRNA-Leu
    4585. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002058 tRNA-Leu
    4586. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002059 tRNA-Leu
    4587. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002060 tRNA-Leu
    4588. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002061 tRNA-Leu
    4589. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002062 tRNA-Leu
    4590. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002063 tRNA-Leu
    4591. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4592. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002065 tRNA-Leu
    4593. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002066 tRNA-Leu
    4594. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002067 tRNA-Leu
    4595. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002068 tRNA-Leu
    4596. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4597. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002071 tRNA-Leu
    4598. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002072 tRNA-Leu
    4599. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002073 tRNA-Leu
    4600. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002074 tRNA-Leu
    4601. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002075 tRNA-Leu
    4602. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00322 tRNA-Leu
    4603. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00323 tRNA-Leu
    4604. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00324 tRNA-Leu
    4605. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00325 tRNA-Leu
    4606. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00326 tRNA-Leu
    4607. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00327 tRNA-Leu
    4608. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00328 tRNA-Leu
    4609. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003463 tRNA-Leu
    4610. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003467 tRNA-Leu
    4611. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003468 tRNA-Leu
    4612. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003469 tRNA-Leu
    4613. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003472 tRNA-Leu
    4614. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003475 tRNA-Leu
    4615. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003482 tRNA-Leu
    4616. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003484 tRNA-Leu
    4617. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003485 tRNA-Leu
    4618. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM20752 tRNA-Leu
    4619. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24359 tRNA-Leu
    4620. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24388 tRNA-Leu
    4621. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24391 tRNA-Leu
    4622. Salmonella enterica subsp. enterica serovar Heidelberg str. N1514 tRNA-Leu
    4623. Salmonella enterica subsp. enterica serovar Heidelberg str. N15757 tRNA-Leu
    4624. Salmonella enterica subsp. enterica serovar Heidelberg str. N18393 tRNA-Leu
    4625. Salmonella enterica subsp. enterica serovar Heidelberg str. N18413 tRNA-Leu
    4626. Salmonella enterica subsp. enterica serovar Heidelberg str. N18440 tRNA-Leu
    4627. Salmonella enterica subsp. enterica serovar Heidelberg str. N18453 tRNA-Leu
    4628. Salmonella enterica subsp. enterica serovar Heidelberg str. N189 tRNA-Leu
    4629. Salmonella enterica subsp. enterica serovar Heidelberg str. N19871 tRNA-Leu
    4630. Salmonella enterica subsp. enterica serovar Heidelberg str. N19992 tRNA-Leu
    4631. Salmonella enterica subsp. enterica serovar Heidelberg str. N20134 tRNA-Leu
    4632. Salmonella enterica subsp. enterica serovar Heidelberg str. N26457 tRNA-Leu
    4633. Salmonella enterica subsp. enterica serovar Heidelberg str. N29341 tRNA-Leu
    4634. Salmonella enterica subsp. enterica serovar Heidelberg str. N30678 tRNA-Leu
    4635. Salmonella enterica subsp. enterica serovar Heidelberg str. N418 tRNA-Leu
    4636. Salmonella enterica subsp. enterica serovar Heidelberg str. N4403 tRNA-Leu
    4637. Salmonella enterica subsp. enterica serovar Heidelberg str. N4496 tRNA-Leu
    4638. Salmonella enterica subsp. enterica serovar Heidelberg str. N4630 tRNA-Leu
    4639. Salmonella enterica subsp. enterica serovar Heidelberg str. N653 tRNA-Leu
    4640. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013193 tRNA-Leu
    4641. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013312 tRNA-Leu
    4642. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013343 tRNA-Leu
    4643. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013374 tRNA-Leu
    4644. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013988 tRNA-Leu
    4645. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014319 tRNA-Leu
    4646. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014588 tRNA-Leu
    4647. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA31 tRNA-Leu
    4648. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA32 tRNA-Leu
    4649. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 tRNA-Leu
    4650. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA37 tRNA-Leu
    4651. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA 39 tRNA-Leu
    4652. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA40 tRNA-Leu
    4653. Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4654. Salmonella enterica subsp. enterica serovar Heidelberg tRNA-Leu(tag)
    4655. Salmonella enterica subsp. enterica serovar Herston tRNA-Leu
    4656. Salmonella enterica subsp. enterica serovar Hessarek tRNA-Leu
    4657. Salmonella enterica subsp. enterica serovar Hillingdon str. N1529-D3 tRNA-Leu
    4658. Salmonella enterica subsp. enterica serovar Hillingdon tRNA-Leu
    4659. Salmonella enterica subsp. enterica serovar Hindmarsh tRNA-Leu
    4660. Salmonella enterica subsp. enterica serovar Hissar tRNA-Leu
    4661. Salmonella enterica subsp. enterica serovar Holcomb tRNA-Leu
    4662. Salmonella enterica subsp. enterica serovar Horsham tRNA-Leu
    4663. Salmonella enterica subsp. enterica serovar Houston tRNA-Leu
    4664. Salmonella enterica subsp. enterica serovar Hull tRNA-Leu
    4665. Salmonella enterica subsp. enterica serovar Hvittingfoss str. A4-620 tRNA-Leu
    4666. Salmonella enterica subsp. enterica serovar Hvittingfoss str. SA20014981 tRNA-Leu
    4667. Salmonella enterica subsp. enterica serovar Hvittingfoss tRNA-Leu
    4668. Salmonella enterica subsp. enterica serovar Ibadan tRNA-Leu
    4669. Salmonella enterica subsp. enterica serovar Idikan tRNA-Leu
    4670. Salmonella enterica subsp. enterica serovar Ilala tRNA-Leu
    4671. Salmonella enterica subsp. enterica serovar Indiana str. ATCC 51959 tRNA-Leu
    4672. Salmonella enterica subsp. enterica serovar Indiana tRNA-Leu
    4673. Salmonella enterica subsp. enterica serovar India str. SA20085604 tRNA-Leu
    4674. Salmonella enterica subsp. enterica serovar Infantis str. 119944 tRNA-Leu
    4675. Salmonella enterica subsp. enterica serovar Infantis str. 335-3 tRNA-Leu
    4676. Salmonella enterica subsp. enterica serovar Infantis str. CFSAN000522 tRNA-Leu
    4677. Salmonella enterica subsp. enterica serovar Infantis str. CVM 17958 tRNA-Leu
    4678. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22577 tRNA-Leu
    4679. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22582 tRNA-Leu
    4680. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23697 tRNA-Leu
    4681. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23729 tRNA-Leu
    4682. Salmonella enterica subsp. enterica serovar Infantis str. CVM 818 tRNA-Leu
    4683. Salmonella enterica subsp. enterica serovar Infantis str. CVM N13139 tRNA-Leu
    4684. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15228 tRNA-Leu
    4685. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15773 tRNA-Leu
    4686. Salmonella enterica subsp. enterica serovar Infantis str. CVM N19983 tRNA-Leu
    4687. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20078 tRNA-Leu
    4688. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20272 tRNA-Leu
    4689. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23532 tRNA-Leu
    4690. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23771 tRNA-Leu
    4691. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23791 tRNA-Leu
    4692. Salmonella enterica subsp. enterica serovar Infantis str. CVM N26093 tRNA-Leu
    4693. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29304 tRNA-Leu
    4694. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29379 tRNA-Leu
    4695. Salmonella enterica subsp. enterica serovar Infantis str. CVM N31594 tRNA-Leu
    4696. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32590PS tRNA-Leu
    4697. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32597PS tRNA-Leu
    4698. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32599PS tRNA-Leu
    4699. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32760 tRNA-Leu
    4700. Salmonella enterica subsp. enterica serovar Infantis str. CVM N34868PS tRNA-Leu
    4701. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35495PS tRNA-Leu
    4702. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35518 tRNA-Leu
    4703. Salmonella enterica subsp. enterica serovar Infantis str. CVM N38848 tRNA-Leu
    4704. Salmonella enterica subsp. enterica serovar Infantis str. CVM N41903 tRNA-Leu
    4705. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42236 tRNA-Leu
    4706. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42459 tRNA-Leu
    4707. Salmonella enterica subsp. enterica serovar Infantis str. SARB27 tRNA-Leu
    4708. Salmonella enterica subsp. enterica serovar Infantis tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4709. Salmonella enterica subsp. enterica serovar Inganda tRNA-Leu
    4710. Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 tRNA-Leu
    4711. Salmonella enterica subsp. enterica serovar Inverness str. R8-3668 tRNA-Leu
    4712. Salmonella enterica subsp. enterica serovar Inverness tRNA-Leu
    4713. Salmonella enterica subsp. enterica serovar Irumu tRNA-Leu
    4714. Salmonella enterica subsp. enterica serovar Isangi tRNA-Leu
    4715. Salmonella enterica subsp. enterica serovar Istanbul tRNA-Leu
    4716. Salmonella enterica subsp. enterica serovar Itami str. SA20014991 tRNA-Leu
    4717. Salmonella enterica subsp. enterica serovar Ituri tRNA-Leu
    4718. Salmonella enterica subsp. enterica serovar Jangwani tRNA-Leu
    4719. Salmonella enterica subsp. enterica serovar Java tRNA-Leu(tag)
    4720. Salmonella enterica subsp. enterica serovar Javiana str. 10721 tRNA-Leu
    4721. Salmonella enterica subsp. enterica serovar Javiana str. ATCC BAA-1593 tRNA-Leu
    4722. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000904 tRNA-Leu
    4723. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000905 tRNA-Leu
    4724. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN001992 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4725. Salmonella enterica subsp. enterica serovar Javiana str. PRS_2010_0720 tRNA-Leu
    4726. Salmonella enterica subsp. enterica serovar Javiana tRNA-Leu
    4727. Salmonella enterica subsp. enterica serovar Jerusalem tRNA-Leu
    4728. Salmonella enterica subsp. enterica serovar Joal tRNA-Leu
    4729. Salmonella enterica subsp. enterica serovar Jodhpur tRNA-Leu
    4730. Salmonella enterica subsp. enterica serovar Johannesburg str. S5-703 tRNA-Leu
    4731. Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 tRNA-Leu
    4732. Salmonella enterica subsp. enterica serovar Johannesburg tRNA-Leu
    4733. Salmonella enterica subsp. enterica serovar Jubilee tRNA-Leu
    4734. Salmonella enterica subsp. enterica serovar Jukestown tRNA-Leu
    4735. Salmonella enterica subsp. enterica serovar Kaapstad tRNA-Leu
    4736. Salmonella enterica subsp. enterica serovar Kalamu tRNA-Leu
    4737. Salmonella enterica subsp. enterica serovar Kambole tRNA-Leu
    4738. Salmonella enterica subsp. enterica serovar Kande tRNA-Leu
    4739. Salmonella enterica subsp. enterica serovar Kandla tRNA-Leu
    4740. Salmonella enterica subsp. enterica serovar Kapemba tRNA-Leu
    4741. Salmonella enterica subsp. enterica serovar Karamoja tRNA-Leu
    4742. Salmonella enterica subsp. enterica serovar Kasenyi tRNA-Leu
    4743. Salmonella enterica subsp. enterica serovar Kastrup tRNA-Leu
    4744. Salmonella enterica subsp. enterica serovar Kedougou tRNA-Leu
    4745. Salmonella enterica subsp. enterica serovar Kentucky str. 0253 tRNA-Leu
    4746. Salmonella enterica subsp. enterica serovar Kentucky str. 13562 tRNA-Leu
    4747. Salmonella enterica subsp. enterica serovar Kentucky str. 20793 tRNA-Leu
    4748. Salmonella enterica subsp. enterica serovar Kentucky str. 22694 tRNA-Leu
    4749. Salmonella enterica subsp. enterica serovar Kentucky str. 29166 tRNA-Leu
    4750. Salmonella enterica subsp. enterica serovar Kentucky str. 29439 tRNA-Leu
    4751. Salmonella enterica subsp. enterica serovar Kentucky str. 5349 tRNA-Leu
    4752. Salmonella enterica subsp. enterica serovar Kentucky str. ATCC 9263 tRNA-Leu
    4753. Salmonella enterica subsp. enterica serovar Kentucky str. N312 tRNA-Leu
    4754. Salmonella enterica subsp. enterica serovar Kentucky str. SA20030505 tRNA-Leu
    4755. Salmonella enterica subsp. enterica serovar Kentucky tRNA-Leu
    4756. Salmonella enterica subsp. enterica serovar Kenya tRNA-Leu
    4757. Salmonella enterica subsp. enterica serovar Kiambu tRNA-Leu
    4758. Salmonella enterica subsp. enterica serovar Kibi tRNA-Leu
    4759. Salmonella enterica subsp. enterica serovar Kibusi tRNA-Leu
    4760. Salmonella enterica subsp. enterica serovar Kimberley tRNA-Leu
    4761. Salmonella enterica subsp. enterica serovar Kimuenza tRNA-Leu
    4762. Salmonella enterica subsp. enterica serovar Kingabwa tRNA-Leu
    4763. Salmonella enterica subsp. enterica serovar Kingston tRNA-Leu
    4764. Salmonella enterica subsp. enterica serovar Kinondoni tRNA-Leu
    4765. Salmonella enterica subsp. enterica serovar Kinshasa tRNA-Leu
    4766. Salmonella enterica subsp. enterica serovar Kintambo tRNA-Leu
    4767. Salmonella enterica subsp. enterica serovar Kirkee tRNA-Leu
    4768. Salmonella enterica subsp. enterica serovar Kisangani tRNA-Leu
    4769. Salmonella enterica subsp. enterica serovar Kisarawe tRNA-Leu
    4770. Salmonella enterica subsp. enterica serovar Kisii tRNA-Leu
    4771. Salmonella enterica subsp. enterica serovar Koessen str. S-1501 tRNA-Leu
    4772. Salmonella enterica subsp. enterica serovar Koketime tRNA-Leu
    4773. Salmonella enterica subsp. enterica serovar Kokomlemle tRNA-Leu
    4774. Salmonella enterica subsp. enterica serovar Kottbus tRNA-Leu
    4775. Salmonella enterica subsp. enterica serovar Kouka tRNA-Leu
    4776. Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 tRNA-Leu
    4777. Salmonella enterica subsp. enterica serovar Krefeld tRNA-Leu
    4778. Salmonella enterica subsp. enterica serovar Kua tRNA-Leu
    4779. Salmonella enterica subsp. enterica serovar Kuessel tRNA-Leu
    4780. Salmonella enterica subsp. enterica serovar Kumasi tRNA-Leu
    4781. Salmonella enterica subsp. enterica serovar Kunzendorf tRNA-Leu
    4782. Salmonella enterica subsp. enterica serovar Lagos tRNA-Leu
    4783. Salmonella enterica subsp. enterica serovar Lanka tRNA-Leu
    4784. Salmonella enterica subsp. enterica serovar Lansing tRNA-Leu
    4785. Salmonella enterica subsp. enterica serovar Larochelle tRNA-Leu
    4786. Salmonella enterica subsp. enterica serovar Lattenkamp tRNA-Leu
    4787. Salmonella enterica subsp. enterica serovar Leeuwarden tRNA-Leu
    4788. Salmonella enterica subsp. enterica serovar Legon tRNA-Leu
    4789. Salmonella enterica subsp. enterica serovar Leoben tRNA-Leu
    4790. Salmonella enterica subsp. enterica serovar Lerum tRNA-Leu
    4791. Salmonella enterica subsp. enterica serovar Lexington tRNA-Leu
    4792. Salmonella enterica subsp. enterica serovar Lexington var. 15+ tRNA-Leu
    4793. Salmonella enterica subsp. enterica serovar Lika tRNA-Leu
    4794. Salmonella enterica subsp. enterica serovar Lille tRNA-Leu
    4795. Salmonella enterica subsp. enterica serovar Limete tRNA-Leu
    4796. Salmonella enterica subsp. enterica serovar Lindern tRNA-Leu
    4797. Salmonella enterica subsp. enterica serovar Linton tRNA-Leu
    4798. Salmonella enterica subsp. enterica serovar Litchfield str. CFSAN001076 tRNA-Leu
    4799. Salmonella enterica subsp. enterica serovar Litchfield tRNA-Leu
    4800. Salmonella enterica subsp. enterica serovar Liverpool tRNA-Leu
    4801. Salmonella enterica subsp. enterica serovar Livingstone tRNA-Leu
    4802. Salmonella enterica subsp. enterica serovar Llandoff tRNA-Leu
    4803. Salmonella enterica subsp. enterica serovar Loanda tRNA-Leu
    4804. Salmonella enterica subsp. enterica serovar Lomalinda tRNA-Leu
    4805. Salmonella enterica subsp. enterica serovar Lome tRNA-Leu
    4806. Salmonella enterica subsp. enterica serovar London str. CFSAN001081 tRNA-Leu
    4807. Salmonella enterica subsp. enterica serovar London tRNA-Leu
    4808. Salmonella enterica subsp. enterica serovar Louisiana tRNA-Leu
    4809. Salmonella enterica subsp. enterica serovar Lubbock tRNA-Leu
    4810. Salmonella enterica subsp. enterica serovar Luciana tRNA-Leu
    4811. Salmonella enterica subsp. enterica serovar Luke tRNA-Leu
    4812. Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 tRNA-Leu
    4813. Salmonella enterica subsp. enterica serovar Madelia tRNA-Leu(tag)
    4814. Salmonella enterica subsp. enterica serovar Malaysia tRNA-Leu
    4815. Salmonella enterica subsp. enterica serovar Malstatt tRNA-Leu
    4816. Salmonella enterica subsp. enterica serovar Manchester str. ST278 tRNA-Leu
    4817. Salmonella enterica subsp. enterica serovar Manchester tRNA-Leu
    4818. Salmonella enterica subsp. enterica serovar Manhattan str. 111113 tRNA-Leu-TAG
    4819. Salmonella enterica subsp. enterica serovar Manhattan str. CFSAN001078 tRNA-Leu
    4820. Salmonella enterica subsp. enterica serovar Manhattan str. SA20034532 tRNA-Leu
    4821. Salmonella enterica subsp. enterica serovar Manhattan tRNA-Leu
    4822. Salmonella enterica subsp. enterica serovar Mapo tRNA-Leu
    4823. Salmonella enterica subsp. enterica serovar Maracaibo tRNA-Leu
    4824. Salmonella enterica subsp. enterica serovar Matadi tRNA-Leu
    4825. Salmonella enterica subsp. enterica serovar Matopeni tRNA-Leu
    4826. Salmonella enterica subsp. enterica serovar Mbandaka str. ATCC 51958 tRNA-Leu
    4827. Salmonella enterica subsp. enterica serovar Mbandaka tRNA-Leu
    4828. Salmonella enterica subsp. enterica serovar Meleagridis str. 0047 tRNA-Leu
    4829. Salmonella enterica subsp. enterica serovar Meleagridis tRNA-Leu
    4830. Salmonella enterica subsp. enterica serovar Memphis tRNA-Leu
    4831. Salmonella enterica subsp. enterica serovar Mendoza tRNA-Leu
    4832. Salmonella enterica subsp. enterica serovar Menston tRNA-Leu
    4833. Salmonella enterica subsp. enterica serovar Mesbit tRNA-Leu
    4834. Salmonella enterica subsp. enterica serovar Mgulani tRNA-Leu
    4835. Salmonella enterica subsp. enterica serovar Miami str. 1923 tRNA-Leu
    4836. Salmonella enterica subsp. enterica serovar Miami str. CFSAN000579 tRNA-Leu
    4837. Salmonella enterica subsp. enterica serovar Miami tRNA-Leu
    4838. Salmonella enterica subsp. enterica serovar Michigan tRNA-Leu
    4839. Salmonella enterica subsp. enterica serovar Middlesbrough tRNA-Leu
    4840. Salmonella enterica subsp. enterica serovar Midway tRNA-Leu
    4841. Salmonella enterica subsp. enterica serovar Mikawasima tRNA-Leu
    4842. Salmonella enterica subsp. enterica serovar Millesi tRNA-Leu
    4843. Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 tRNA-Leu
    4844. Salmonella enterica subsp. enterica serovar Minneapolis tRNA-Leu
    4845. Salmonella enterica subsp. enterica serovar Minnesota str. A4-603 tRNA-Leu
    4846. Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 tRNA-Leu
    4847. Salmonella enterica subsp. enterica serovar Minnesota tRNA-Leu
    4848. Salmonella enterica subsp. enterica serovar Mishmarhaemek tRNA-Leu
    4849. Salmonella enterica subsp. enterica serovar Mississippi str. A4-633 tRNA-Leu
    4850. Salmonella enterica subsp. enterica serovar Mississippi tRNA-Leu
    4851. Salmonella enterica subsp. enterica serovar Moero tRNA-Leu
    4852. Salmonella enterica subsp. enterica serovar Mokola tRNA-Leu
    4853. Salmonella enterica subsp. enterica serovar Molade tRNA-Leu
    4854. Salmonella enterica subsp. enterica serovar Monophasic tRNA-Leu
    4855. Salmonella enterica subsp. enterica serovar Monschaui tRNA-Leu
    4856. Salmonella enterica subsp. enterica serovar Montevideo str. 19N tRNA-Leu
    4857. Salmonella enterica subsp. enterica serovar Montevideo str. 2009083312 tRNA-Leu
    4858. Salmonella enterica subsp. enterica serovar Montevideo str. 2009085258 tRNA-Leu
    4859. Salmonella enterica subsp. enterica serovar Montevideo str. 29N tRNA-Leu
    4860. Salmonella enterica subsp. enterica serovar Montevideo str. 315731156 tRNA-Leu
    4861. Salmonella enterica subsp. enterica serovar Montevideo str. 315996572 tRNA-Leu
    4862. Salmonella enterica subsp. enterica serovar Montevideo str. 316111868 tRNA-Leu
    4863. Salmonella enterica subsp. enterica serovar Montevideo str. 366867 tRNA-Leu
    4864. Salmonella enterica subsp. enterica serovar Montevideo str. 413180 tRNA-Leu
    4865. Salmonella enterica subsp. enterica serovar Montevideo str. 414877 tRNA-Leu
    4866. Salmonella enterica subsp. enterica serovar Montevideo str. 42N tRNA-Leu
    4867. Salmonella enterica subsp. enterica serovar Montevideo str. 4441 H tRNA-Leu
    4868. Salmonella enterica subsp. enterica serovar Montevideo str. 446600 tRNA-Leu
    4869. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-1 tRNA-Leu
    4870. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-3 tRNA-Leu
    4871. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-4 tRNA-Leu
    4872. Salmonella enterica subsp. enterica serovar Montevideo str. 507440-20 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4873. Salmonella enterica subsp. enterica serovar Montevideo str. 515920-1 tRNA-Leu
    4874. Salmonella enterica subsp. enterica serovar Montevideo str. 515920-2 tRNA-Leu
    4875. Salmonella enterica subsp. enterica serovar Montevideo str. 531954 tRNA-Leu
    4876. Salmonella enterica subsp. enterica serovar Montevideo str. 556152 tRNA-Leu
    4877. Salmonella enterica subsp. enterica serovar Montevideo str. 609458-1 tRNA-Leu
    4878. Salmonella enterica subsp. enterica serovar Montevideo str. 609458-2 tRNA-Leu
    4879. Salmonella enterica subsp. enterica serovar Montevideo str. 644129 tRNA-Leu
    4880. Salmonella enterica subsp. enterica serovar Montevideo str. 80959-06 tRNA-Leu
    4881. Salmonella enterica subsp. enterica serovar Montevideo str. 81038-01 tRNA-Leu
    4882. Salmonella enterica subsp. enterica serovar Montevideo str. ATCC BAA710 tRNA-Leu
    4883. Salmonella enterica subsp. enterica serovar Montevideo str. CASC_09SCPH15965 tRNA-Leu
    4884. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 07-0954 tRNA-Leu
    4885. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 08-1942 tRNA-Leu
    4886. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 tRNA-Leu
    4887. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 tRNA-Leu
    4888. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2011K-1674 tRNA-Leu
    4889. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2012K-1544 tRNA-Leu
    4890. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2013K-0218 tRNA-Leu
    4891. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 86-0391 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4892. Salmonella enterica subsp. enterica serovar Montevideo str. CFSAN004346 tRNA-Leu
    4893. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035278 tRNA-Leu
    4894. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035318 tRNA-Leu
    4895. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035320 tRNA-Leu
    4896. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035321 tRNA-Leu
    4897. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035327 tRNA-Leu
    4898. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-2868 tRNA-Leu
    4899. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4673 tRNA-Leu
    4900. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4843 tRNA-Leu
    4901. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4916 tRNA-Leu
    4902. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4922 tRNA-Leu
    4903. Salmonella enterica subsp. enterica serovar Montevideo str. FVM_628064 tRNA-Leu
    4904. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008282 tRNA-Leu
    4905. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008284 tRNA-Leu
    4906. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008285 tRNA-Leu
    4907. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008286 tRNA-Leu
    4908. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008287 tRNA-Leu
    4909. Salmonella enterica subsp. enterica serovar Montevideo str. LQC 10 tRNA-Leu
    4910. Salmonella enterica subsp. enterica serovar Montevideo str. MB101509-0077 tRNA-Leu
    4911. Salmonella enterica subsp. enterica serovar Montevideo str. MB102109-0047 tRNA-Leu
    4912. Salmonella enterica subsp. enterica serovar Montevideo str. MB110209-0055 tRNA-Leu
    4913. Salmonella enterica subsp. enterica serovar Montevideo str. MB111609-0052 tRNA-Leu
    4914. Salmonella enterica subsp. enterica serovar Montevideo str. MD_MDA09249507 tRNA-Leu
    4915. Salmonella enterica subsp. enterica serovar Montevideo str. N19965 tRNA-Leu
    4916. Salmonella enterica subsp. enterica serovar Montevideo str. S5-403 tRNA-Leu
    4917. Salmonella enterica subsp. enterica serovar Montevideo str. SARB30 tRNA-Leu
    4918. Salmonella enterica subsp. enterica serovar Montevideo str. SARB31 tRNA-Leu
    4919. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1900 tRNA-Leu
    4920. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1901 tRNA-Leu
    4921. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1903 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4922. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1904 tRNA-Leu
    4923. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1912 tRNA-Leu
    4924. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 tRNA-Leu
    4925. Salmonella enterica subsp. enterica serovar Montevideo tRNA-Leu(tag)
    4926. Salmonella enterica subsp. enterica serovar Morehead tRNA-Leu
    4927. Salmonella enterica subsp. enterica serovar Moroto tRNA-Leu
    4928. Salmonella enterica subsp. enterica serovar Moscow str. S-1843 tRNA-Leu
    4929. Salmonella enterica subsp. enterica serovar Moscow str. SA20061414 tRNA-Leu
    4930. Salmonella enterica subsp. enterica serovar Moscow tRNA-Leu
    4931. Salmonella enterica subsp. enterica serovar Mountpleasant tRNA-Leu
    4932. Salmonella enterica subsp. enterica serovar Muenchen str. ATCC 8388 tRNA-Leu
    4933. Salmonella enterica subsp. enterica serovar Muenchen str. baa1594 tRNA-Leu
    4934. Salmonella enterica subsp. enterica serovar Muenchen str. baa1674 tRNA-Leu
    4935. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000585 tRNA-Leu
    4936. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000591 tRNA-Leu
    4937. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000593 tRNA-Leu
    4938. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000595 tRNA-Leu
    4939. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000596 tRNA-Leu
    4940. Salmonella enterica subsp. enterica serovar Muenchen str. RKS4129 tRNA-Leu
    4941. Salmonella enterica subsp. enterica serovar Muenchen tRNA-Leu
    4942. Salmonella enterica subsp. enterica serovar Muenster str. 0315 tRNA-Leu
    4943. Salmonella enterica subsp. enterica serovar Muenster str. 420 tRNA-Leu
    4944. Salmonella enterica subsp. enterica serovar Muenster str. 660 tRNA-Leu
    4945. Salmonella enterica subsp. enterica serovar Muenster str. CFSAN004344 tRNA-Leu
    4946. Salmonella enterica subsp. enterica serovar Muenster tRNA-Leu
    4947. Salmonella enterica subsp. enterica serovar Nagoya tRNA-Leu
    4948. Salmonella enterica subsp. enterica serovar Namur str. 05-2929 tRNA-Leu
    4949. Salmonella enterica subsp. enterica serovar Napoli tRNA-Leu
    4950. Salmonella enterica subsp. enterica serovar Nchanga str. CFSAN001091 tRNA-Leu
    4951. Salmonella enterica subsp. enterica serovar Nchanga str. CFSAN001092 tRNA-Leu
    4952. Salmonella enterica subsp. enterica serovar Nchanga tRNA-Leu
    4953. Salmonella enterica subsp. enterica serovar Ndolo tRNA-Leu
    4954. Salmonella enterica subsp. enterica serovar Nessziona tRNA-Leu
    4955. Salmonella enterica subsp. enterica serovar Neukoelln tRNA-Leu
    4956. Salmonella enterica subsp. enterica serovar Neunkirchen tRNA-Leu
    4957. Salmonella enterica subsp. enterica serovar Newbrunswick tRNA-Leu
    4958. Salmonella enterica subsp. enterica serovar Newington tRNA-Leu
    4959. Salmonella enterica subsp. enterica serovar Newlands tRNA-Leu
    4960. Salmonella enterica subsp. enterica serovar Newmexico tRNA-Leu
    4961. Salmonella enterica subsp. enterica serovar Newport str. #11-2 tRNA-Leu
    4962. Salmonella enterica subsp. enterica serovar Newport str. #11-3 tRNA-Leu
    4963. Salmonella enterica subsp. enterica serovar Newport str. #11-4 tRNA-Leu
    4964. Salmonella enterica subsp. enterica serovar Newport str. 36799 tRNA-Leu
    4965. Salmonella enterica subsp. enterica serovar Newport str. 36801 tRNA-Leu
    4966. Salmonella enterica subsp. enterica serovar Newport str. 36803 tRNA-Leu
    4967. Salmonella enterica subsp. enterica serovar Newport str. 36804 tRNA-Leu
    4968. Salmonella enterica subsp. enterica serovar Newport str. 36805 tRNA-Leu
    4969. Salmonella enterica subsp. enterica serovar Newport str. 637564_17 tRNA-Leu
    4970. Salmonella enterica subsp. enterica serovar Newport str. A182RVB tRNA-Leu
    4971. Salmonella enterica subsp. enterica serovar Newport str. A-211-RVH tRNA-Leu
    4972. Salmonella enterica subsp. enterica serovar Newport str. A-211-TTX tRNA-Leu
    4973. Salmonella enterica subsp. enterica serovar Newport str. CDC 2009K-1331 tRNA-Leu
    4974. Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    4975. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 tRNA-Leu
    4976. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 tRNA-Leu
    4977. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000597 tRNA-Leu
    4978. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000598 tRNA-Leu
    4979. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000599 tRNA-Leu
    4980. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000826 tRNA-Leu
    4981. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000827 tRNA-Leu
    4982. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000828 tRNA-Leu
    4983. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000830 tRNA-Leu
    4984. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000831 tRNA-Leu
    4985. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000832 tRNA-Leu
    4986. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000833 tRNA-Leu
    4987. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000834 tRNA-Leu
    4988. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000835 tRNA-Leu
    4989. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000837 tRNA-Leu
    4990. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000901 tRNA-Leu
    4991. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001889 tRNA-Leu
    4992. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001890 tRNA-Leu
    4993. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001894 tRNA-Leu
    4994. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001895 tRNA-Leu
    4995. Salmonella enterica subsp. enterica serovar Newport str. CVM17619 tRNA-Leu
    4996. Salmonella enterica subsp. enterica serovar Newport str. CVM18000 tRNA-Leu
    4997. Salmonella enterica subsp. enterica serovar Newport str. CVM18005 tRNA-Leu
    4998. Salmonella enterica subsp. enterica serovar Newport str. CVM 19443 tRNA-Leu
    4999. Salmonella enterica subsp. enterica serovar Newport str. CVM 19447 tRNA-Leu
    5000. Salmonella enterica subsp. enterica serovar Newport str. CVM 19449 tRNA-Leu
    5001. Salmonella enterica subsp. enterica serovar Newport str. CVM 19470 tRNA-Leu
    5002. Salmonella enterica subsp. enterica serovar Newport str. CVM 19536 tRNA-Leu
    5003. Salmonella enterica subsp. enterica serovar Newport str. CVM 19567 tRNA-Leu
    5004. Salmonella enterica subsp. enterica serovar Newport str. CVM 19593 tRNA-Leu
    5005. Salmonella enterica subsp. enterica serovar Newport str. CVM20775 tRNA-Leu
    5006. Salmonella enterica subsp. enterica serovar Newport str. CVM20776 tRNA-Leu
    5007. Salmonella enterica subsp. enterica serovar Newport str. CVM21537 tRNA-Leu
    5008. Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5009. Salmonella enterica subsp. enterica serovar Newport str. CVM 21539 tRNA-Leu
    5010. Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5011. Salmonella enterica subsp. enterica serovar Newport str. CVM 21554 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5012. Salmonella enterica subsp. enterica serovar Newport str. CVM 21559 tRNA-Leu
    5013. Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5014. Salmonella enterica subsp. enterica serovar Newport str. CVM22443 tRNA-Leu
    5015. Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5016. Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5017. Salmonella enterica subsp. enterica serovar Newport str. CVM22697 tRNA-Leu
    5018. Salmonella enterica subsp. enterica serovar Newport str. CVM22699 tRNA-Leu
    5019. Salmonella enterica subsp. enterica serovar Newport str. CVM22707 tRNA-Leu
    5020. Salmonella enterica subsp. enterica serovar Newport str. CVM24403 tRNA-Leu
    5021. Salmonella enterica subsp. enterica serovar Newport str. CVM30171 tRNA-Leu
    5022. Salmonella enterica subsp. enterica serovar Newport str. CVM 33953 tRNA-Leu
    5023. Salmonella enterica subsp. enterica serovar Newport str. CVM34519 tRNA-Leu
    5024. Salmonella enterica subsp. enterica serovar Newport str. CVM 35185 tRNA-Leu
    5025. Salmonella enterica subsp. enterica serovar Newport str. CVM 35202 tRNA-Leu
    5026. Salmonella enterica subsp. enterica serovar Newport str. CVM 37978 tRNA-Leu
    5027. Salmonella enterica subsp. enterica serovar Newport str. CVM 4176 tRNA-Leu
    5028. Salmonella enterica subsp. enterica serovar Newport str. CVM75_1280 tRNA-Leu
    5029. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1357 tRNA-Leu
    5030. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1594 tRNA-Leu
    5031. Salmonella enterica subsp. enterica serovar Newport str. CVM80_2288 tRNA-Leu
    5032. Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5033. Salmonella enterica subsp. enterica serovar Newport str. CVM N18486 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5034. Salmonella enterica subsp. enterica serovar Newport str. DC_10-446 tRNA-Leu
    5035. Salmonella enterica subsp. enterica serovar Newport str. DC_10-449 tRNA-Leu
    5036. Salmonella enterica subsp. enterica serovar Newport str. DC_10-450 tRNA-Leu
    5037. Salmonella enterica subsp. enterica serovar Newport str. Henan_3 tRNA-Leu
    5038. Salmonella enterica subsp. enterica serovar Newport str. JS09102 tRNA-Leu
    5039. Salmonella enterica subsp. enterica serovar Newport str. L0167 tRNA-Leu
    5040. Salmonella enterica subsp. enterica serovar Newport str. Levine 15 tRNA-Leu
    5041. Salmonella enterica subsp. enterica serovar Newport str. Levine 1 tRNA-Leu
    5042. Salmonella enterica subsp. enterica serovar Newport str. MA_10EN1469 tRNA-Leu
    5043. Salmonella enterica subsp. enterica serovar Newport str. Pond080-2TTA tRNA-Leu
    5044. Salmonella enterica subsp. enterica serovar Newport str. PRS_2010_0624 tRNA-Leu
    5045. Salmonella enterica subsp. enterica serovar Newport str. RI_10P069 tRNA-Leu
    5046. Salmonella enterica subsp. enterica serovar Newport str. RI_10P078 tRNA-Leu
    5047. Salmonella enterica subsp. enterica serovar Newport str. RI_10P079 tRNA-Leu
    5048. Salmonella enterica subsp. enterica serovar Newport str. S103RVX tRNA-Leu
    5049. Salmonella enterica subsp. enterica serovar Newport str. SH111077 tRNA-Leu
    5050. Salmonella enterica subsp. enterica serovar Newport str. Shandong_3 tRNA-Leu
    5051. Salmonella enterica subsp. enterica serovar Newport str. SHSN001 tRNA-Leu
    5052. Salmonella enterica subsp. enterica serovar Newport str. SHSN002 tRNA-Leu
    5053. Salmonella enterica subsp. enterica serovar Newport str. SHSN003 tRNA-Leu
    5054. Salmonella enterica subsp. enterica serovar Newport str. SHSN005 tRNA-Leu
    5055. Salmonella enterica subsp. enterica serovar Newport str. SHSN007 tRNA-Leu
    5056. Salmonella enterica subsp. enterica serovar Newport str. SHSN008 tRNA-Leu
    5057. Salmonella enterica subsp. enterica serovar Newport str. SHSN009 tRNA-Leu
    5058. Salmonella enterica subsp. enterica serovar Newport str. SHSN010 tRNA-Leu
    5059. Salmonella enterica subsp. enterica serovar Newport str. SHSN011 tRNA-Leu
    5060. Salmonella enterica subsp. enterica serovar Newport str. SHSN013 tRNA-Leu
    5061. Salmonella enterica subsp. enterica serovar Newport str. SHSN014 tRNA-Leu
    5062. Salmonella enterica subsp. enterica serovar Newport str. SL254 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5063. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 tRNA-Leu
    5064. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 tRNA-Leu
    5065. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 tRNA-Leu
    5066. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 tRNA-Leu
    5067. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1927 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5068. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 tRNA-Leu
    5069. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 tRNA-Leu
    5070. Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5071. Salmonella enterica subsp. enterica serovar Newport str. VA_R100506907 tRNA-Leu
    5072. Salmonella enterica subsp. enterica serovar Newport str. VA_R100512570 tRNA-Leu
    5073. Salmonella enterica subsp. enterica serovar Newport str. VA_R100512572 tRNA-Leu
    5074. Salmonella enterica subsp. enterica serovar Newport str. VA_R100804798 tRNA-Leu
    5075. Salmonella enterica subsp. enterica serovar Newport str. VA_R100808502 tRNA-Leu
    5076. Salmonella enterica subsp. enterica serovar Newport str. WA_14881 tRNA-Leu
    5077. Salmonella enterica subsp. enterica serovar Newport str. WA_14882 tRNA-Leu
    5078. Salmonella enterica subsp. enterica serovar Newport str. WA_14885 tRNA-Leu
    5079. Salmonella enterica subsp. enterica serovar Newport str. WA_14900 tRNA-Leu
    5080. Salmonella enterica subsp. enterica serovar Newport tRNA-Leu
    5081. Salmonella enterica subsp. enterica serovar Newyork tRNA-Leu
    5082. Salmonella enterica subsp. enterica serovar Ngili tRNA-Leu
    5083. Salmonella enterica subsp. enterica serovar Nigeria tRNA-Leu
    5084. Salmonella enterica subsp. enterica serovar Nijmegen tRNA-Leu
    5085. Salmonella enterica subsp. enterica serovar Nima tRNA-Leu
    5086. Salmonella enterica subsp. enterica serovar Nitra tRNA-Leu
    5087. Salmonella enterica subsp. enterica serovar Norwich str. CFSAN001077 tRNA-Leu
    5088. Salmonella enterica subsp. enterica serovar Norwich tRNA-Leu
    5089. Salmonella enterica subsp. enterica serovar Nottingham tRNA-Leu
    5090. Salmonella enterica subsp. enterica serovar Noya tRNA-Leu
    5091. Salmonella enterica subsp. enterica serovar Nyanza tRNA-Leu
    5092. Salmonella enterica subsp. enterica serovar Oakland tRNA-Leu
    5093. Salmonella enterica subsp. enterica serovar Obogu tRNA-Leu
    5094. Salmonella enterica subsp. enterica serovar Odozi tRNA-Leu
    5095. Salmonella enterica subsp. enterica serovar Offa tRNA-Leu
    5096. Salmonella enterica subsp. enterica serovar Ohio str. CFSAN001079 tRNA-Leu
    5097. Salmonella enterica subsp. enterica serovar Ohio tRNA-Leu
    5098. Salmonella enterica subsp. enterica serovar Okatie tRNA-Leu
    5099. Salmonella enterica subsp. enterica serovar Omderman tRNA-Leu
    5100. Salmonella enterica subsp. enterica serovar Omuna tRNA-Leu
    5101. Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 tRNA-Leu
    5102. Salmonella enterica subsp. enterica serovar Onderstepoort tRNA-Leu
    5103. Salmonella enterica subsp. enterica serovar Onireke tRNA-Leu
    5104. Salmonella enterica subsp. enterica serovar Oranienburg str. 0250 tRNA-Leu
    5105. Salmonella enterica subsp. enterica serovar Oranienburg str. 701 tRNA-Leu
    5106. Salmonella enterica subsp. enterica serovar Oranienburg str. S-76 tRNA-Leu
    5107. Salmonella enterica subsp. enterica serovar Oranienburg tRNA-Leu(tag)
    5108. Salmonella enterica subsp. enterica serovar Ordonez tRNA-Leu
    5109. Salmonella enterica subsp. enterica serovar Orientalis tRNA-Leu
    5110. Salmonella enterica subsp. enterica serovar Orion tRNA-Leu
    5111. Salmonella enterica subsp. enterica serovar O Rough:a:- tRNA-Leu
    5112. Salmonella enterica subsp. enterica serovar O rough tRNA-Leu
    5113. Salmonella enterica subsp. enterica serovar Oskarshamn tRNA-Leu
    5114. Salmonella enterica subsp. enterica serovar Oslo tRNA-Leu
    5115. Salmonella enterica subsp. enterica serovar Othmarschen tRNA-Leu
    5116. Salmonella enterica subsp. enterica serovar Ouagadougou tRNA-Leu
    5117. Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 tRNA-Leu
    5118. Salmonella enterica subsp. enterica serovar Ouakam tRNA-Leu
    5119. Salmonella enterica subsp. enterica serovar Oudwijk tRNA-Leu
    5120. Salmonella enterica subsp. enterica serovar Overschie tRNA-Leu
    5121. Salmonella enterica subsp. enterica serovar Pakistan tRNA-Leu
    5122. Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 tRNA-Leu
    5123. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000600 tRNA-Leu
    5124. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000601 tRNA-Leu
    5125. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000602 tRNA-Leu
    5126. Salmonella enterica subsp. enterica serovar Panama str. SA20030878 tRNA-Leu
    5127. Salmonella enterica subsp. enterica serovar Panama tRNA-Leu(tag)
    5128. Salmonella enterica subsp. enterica serovar Papuana tRNA-Leu
    5129. Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5130. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 tRNA-Leu
    5131. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5132. Salmonella enterica subsp. enterica serovar Paratyphi A str. SA19950809 tRNA-Leu
    5133. Salmonella enterica subsp. enterica serovar Paratyphi A tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5134. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 10719 tRNA-Leu
    5135. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 19940 tRNA-Leu
    5136. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 8759 tRNA-Leu
    5137. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC BAA-1585 tRNA-Leu
    5138. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000527 tRNA-Leu
    5139. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000532 tRNA-Leu
    5140. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000536 tRNA-Leu
    5141. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000540 tRNA-Leu
    5142. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000541 tRNA-Leu
    5143. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000542 tRNA-Leu
    5144. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000545 tRNA-Leu
    5145. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000547 tRNA-Leu
    5146. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000548 tRNA-Leu
    5147. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000549 tRNA-Leu
    5148. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA42 tRNA-Leu
    5149. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA61 tRNA-Leu
    5150. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA62 tRNA-Leu
    5151. Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5152. Salmonella enterica subsp. enterica serovar Paratyphi B tRNA-Leu
    5153. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000603 tRNA-Leu
    5154. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000604 tRNA-Leu
    5155. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000605 tRNA-Leu
    5156. Salmonella enterica subsp. enterica serovar Paratyphi C str. RKS4594 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5157. Salmonella enterica subsp. enterica serovar Paratyphi C tRNA-Leu(tag)
    5158. Salmonella enterica subsp. enterica serovar Parkroyal tRNA-Leu
    5159. Salmonella enterica subsp. enterica serovar Pasing tRNA-Leu
    5160. Salmonella enterica subsp. enterica serovar Penarth tRNA-Leu
    5161. Salmonella enterica subsp. enterica serovar Pensacola tRNA-Leu
    5162. Salmonella enterica subsp. enterica serovar Plymouth tRNA-Leu
    5163. Salmonella enterica subsp. enterica serovar Poano tRNA-Leu
    5164. Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 tRNA-Leu
    5165. Salmonella enterica subsp. enterica serovar Pomona tRNA-Leu
    5166. Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 tRNA-Leu
    5167. Salmonella enterica subsp. enterica serovar Poona tRNA-Leu(tag)
    5168. Salmonella enterica subsp. enterica serovar Potsdam tRNA-Leu
    5169. Salmonella enterica subsp. enterica serovar Praha tRNA-Leu
    5170. Salmonella enterica subsp. enterica serovar Pretoria tRNA-Leu
    5171. Salmonella enterica subsp. enterica serovar Pullorum str. 13036 tRNA-Leu
    5172. Salmonella enterica subsp. enterica serovar Pullorum str. 19945 tRNA-Leu
    5173. Salmonella enterica subsp. enterica serovar Pullorum str. ATCC 9120 tRNA-Leu
    5174. Salmonella enterica subsp. enterica serovar Pullorum str. CFSAN000606 tRNA-Leu
    5175. Salmonella enterica subsp. enterica serovar Pullorum str. S06004 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5176. Salmonella enterica subsp. enterica serovar Pullorum tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5177. Salmonella enterica subsp. enterica serovar Putten tRNA-Leu
    5178. Salmonella enterica subsp. enterica serovar Quebec str. S-1267 tRNA-Leu
    5179. Salmonella enterica subsp. enterica serovar -:r:1,5 tRNA-Leu
    5180. Salmonella enterica subsp. enterica serovar Rauform tRNA-Leu
    5181. Salmonella enterica subsp. enterica serovar Reading tRNA-Leu
    5182. Salmonella enterica subsp. enterica serovar Redba tRNA-Leu
    5183. Salmonella enterica subsp. enterica serovar Redlands tRNA-Leu
    5184. Salmonella enterica subsp. enterica serovar Remiremont tRNA-Leu
    5185. Salmonella enterica subsp. enterica serovar Richmond tRNA-Leu
    5186. Salmonella enterica subsp. enterica serovar Rideau tRNA-Leu
    5187. Salmonella enterica subsp. enterica serovar Ridge tRNA-Leu
    5188. Salmonella enterica subsp. enterica serovar Rissen str. 150 tRNA-Leu
    5189. Salmonella enterica subsp. enterica serovar Rissen tRNA-Leu
    5190. Salmonella enterica subsp. enterica serovar Roodepoort tRNA-Leu
    5191. Salmonella enterica subsp. enterica serovar Rostock tRNA-Leu
    5192. Salmonella enterica subsp. enterica serovar Rottnest tRNA-Leu
    5193. Salmonella enterica subsp. enterica serovar Rough:b:1,2 tRNA-Leu
    5194. Salmonella enterica subsp. enterica serovar Rough O:d:1,7 tRNA-Leu
    5195. Salmonella enterica subsp. enterica serovar Rough O:-:- tRNA-Leu
    5196. Salmonella enterica subsp. enterica serovar Rough:- tRNA-Leu
    5197. Salmonella enterica subsp. enterica serovar Rovaniemi tRNA-Leu
    5198. Salmonella enterica subsp. enterica serovar Rubislaw str. A4-653 tRNA-Leu
    5199. Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 tRNA-Leu
    5200. Salmonella enterica subsp. enterica serovar Rubislaw str. SA20030553 tRNA-Leu
    5201. Salmonella enterica subsp. enterica serovar Rubislaw tRNA-Leu
    5202. Salmonella enterica subsp. enterica serovar Ruiru tRNA-Leu
    5203. Salmonella enterica subsp. enterica serovar Saarbruecken tRNA-Leu
    5204. Salmonella enterica subsp. enterica serovar Saintpaul str. 9712 tRNA-Leu
    5205. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000612 tRNA-Leu
    5206. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000618 tRNA-Leu
    5207. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000619 tRNA-Leu
    5208. Salmonella enterica subsp. enterica serovar Saintpaul str. JO2008 tRNA-Leu
    5209. Salmonella enterica subsp. enterica serovar Saintpaul str. S-70 tRNA-Leu
    5210. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA26 tRNA-Leu
    5211. Salmonella enterica subsp. enterica serovar Saintpaul tRNA-Leu
    5212. Salmonella enterica subsp. enterica serovar Salford tRNA-Leu
    5213. Salmonella enterica subsp. enterica serovar Sandiego tRNA-Leu
    5214. Salmonella enterica subsp. enterica serovar Sangera tRNA-Leu
    5215. Salmonella enterica subsp. enterica serovar Sanjuan tRNA-Leu(tag)
    5216. Salmonella enterica subsp. enterica serovar Saphra tRNA-Leu
    5217. Salmonella enterica subsp. enterica serovar Sarajane tRNA-Leu
    5218. Salmonella enterica subsp. enterica serovar Schleissheim tRNA-Leu
    5219. Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5220. Salmonella enterica subsp. enterica serovar Schwarzengrund tRNA-Leu
    5221. Salmonella enterica subsp. enterica serovar Seattle tRNA-Leu
    5222. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-Leu
    5223. Salmonella enterica subsp. enterica serovar Sekondi tRNA-Leu
    5224. Salmonella enterica subsp. enterica serovar Sendai str. CFSAN000621 tRNA-Leu
    5225. Salmonella enterica subsp. enterica serovar Sendai tRNA-Leu(tag)
    5226. Salmonella enterica subsp. enterica serovar Senegal tRNA-Leu
    5227. Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 tRNA-Leu
    5228. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-2 tRNA-Leu
    5229. Salmonella enterica subsp. enterica serovar Senftenberg str. 604314 tRNA-Leu
    5230. Salmonella enterica subsp. enterica serovar Senftenberg str. A4-543 tRNA-Leu
    5231. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 tRNA-Leu
    5232. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 8400 tRNA-Leu
    5233. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 tRNA-Leu
    5234. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004030 tRNA-Leu
    5235. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004031 tRNA-Leu
    5236. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004032 tRNA-Leu
    5237. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004033 tRNA-Leu
    5238. Salmonella enterica subsp. enterica serovar Senftenberg str. SS209 transfer RNA-Leu
    5239. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-Leu(tag)
    5240. Salmonella enterica subsp. enterica serovar Senneville tRNA-Leu
    5241. Salmonella enterica subsp. enterica serovar Shamba tRNA-Leu
    5242. Salmonella enterica subsp. enterica serovar Shubra tRNA-Leu
    5243. Salmonella enterica subsp. enterica serovar Singapore tRNA-Leu
    5244. Salmonella enterica subsp. enterica serovar Sinstorf tRNA-Leu
    5245. Salmonella enterica subsp. enterica serovar Sloterdijk str. ATCC 15791 tRNA-Leu
    5246. Salmonella enterica subsp. enterica serovar Soerenga str. 695 tRNA-Leu
    5247. Salmonella enterica subsp. enterica serovar Soerenga tRNA-Leu
    5248. Salmonella enterica subsp. enterica serovar Somone tRNA-Leu
    5249. Salmonella enterica subsp. enterica serovar Southampton tRNA-Leu
    5250. Salmonella enterica subsp. enterica serovar Southbank tRNA-Leu
    5251. Salmonella enterica subsp. enterica serovar Stanley str. ATCC 7308 tRNA-Leu
    5252. Salmonella enterica subsp. enterica serovar Stanley str. CFSAN000623 tRNA-Leu
    5253. Salmonella enterica subsp. enterica serovar Stanley tRNA-Leu(tag)
    5254. Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 tRNA-Leu
    5255. Salmonella enterica subsp. enterica serovar Stanleyville tRNA-Leu
    5256. Salmonella enterica subsp. enterica serovar Stockholm tRNA-Leu
    5257. Salmonella enterica subsp. enterica serovar Stourbridge tRNA-Leu
    5258. Salmonella enterica subsp. enterica serovar Strathcona tRNA-Leu
    5259. Salmonella enterica subsp. enterica serovar Stuttgart tRNA-Leu
    5260. Salmonella enterica subsp. enterica serovar Suberu tRNA-Leu
    5261. Salmonella enterica subsp. enterica serovar Suelldorf tRNA-Leu
    5262. Salmonella enterica subsp. enterica serovar Sundsvall tRNA-Leu
    5263. Salmonella enterica subsp. enterica serovar Szentes tRNA-Leu
    5264. Salmonella enterica subsp. enterica serovar Tafo tRNA-Leu
    5265. Salmonella enterica subsp. enterica serovar Takoradi tRNA-Leu
    5266. Salmonella enterica subsp. enterica serovar Taksony tRNA-Leu
    5267. Salmonella enterica subsp. enterica serovar Tallahassee str. 0012 tRNA-Leu
    5268. Salmonella enterica subsp. enterica serovar Tallahassee tRNA-Leu
    5269. Salmonella enterica subsp. enterica serovar Tamberma tRNA-Leu
    5270. Salmonella enterica subsp. enterica serovar Tananarive tRNA-Leu
    5271. Salmonella enterica subsp. enterica serovar Tanger tRNA-Leu
    5272. Salmonella enterica subsp. enterica serovar Tchad tRNA-Leu
    5273. Salmonella enterica subsp. enterica serovar Teddington tRNA-Leu
    5274. Salmonella enterica subsp. enterica serovar Tees tRNA-Leu
    5275. Salmonella enterica subsp. enterica serovar Teko tRNA-Leu
    5276. Salmonella enterica subsp. enterica serovar Telaviv tRNA-Leu
    5277. Salmonella enterica subsp. enterica serovar Telelkebir tRNA-Leu
    5278. Salmonella enterica subsp. enterica serovar Telhashomer tRNA-Leu
    5279. Salmonella enterica subsp. enterica serovar Teltow tRNA-Leu
    5280. Salmonella enterica subsp. enterica serovar Tennessee str. 2691 tRNA-Leu
    5281. Salmonella enterica subsp. enterica serovar Tennessee str. 3133 tRNA-Leu
    5282. Salmonella enterica subsp. enterica serovar Tennessee str. 4535 tRNA-Leu
    5283. Salmonella enterica subsp. enterica serovar Tennessee str. PBO2007 tRNA-Leu
    5284. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-19 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5285. Salmonella enterica subsp. enterica serovar Tennessee tRNA-Leu
    5286. Salmonella enterica subsp. enterica serovar Teshie tRNA-Leu
    5287. Salmonella enterica subsp. enterica serovar Texas tRNA-Leu
    5288. Salmonella enterica subsp. enterica serovar Thompson str. ATCC 8391 tRNA-Leu
    5289. Salmonella enterica subsp. enterica serovar Thompson str. CFSAN000625 tRNA-Leu
    5290. Salmonella enterica subsp. enterica serovar Thompson tRNA-Leu(tag)
    5291. Salmonella enterica subsp. enterica serovar Tilene tRNA-Leu
    5292. Salmonella enterica subsp. enterica serovar Togba tRNA-Leu
    5293. Salmonella enterica subsp. enterica serovar Toucra tRNA-Leu
    5294. Salmonella enterica subsp. enterica serovar Toulon tRNA-Leu
    5295. Salmonella enterica subsp. enterica serovar Treforest tRNA-Leu
    5296. Salmonella enterica subsp. enterica serovar Tudu tRNA-Leu
    5297. Salmonella enterica subsp. enterica serovar Typhimurium str. 104772 tRNA-Leu
    5298. Salmonella enterica subsp. enterica serovar Typhimurium str. 108402 tRNA-Leu
    5299. Salmonella enterica subsp. enterica serovar Typhimurium str. 116045 tRNA-Leu
    5300. Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5301. Salmonella enterica subsp. enterica serovar Typhimurium str. 34502 tRNA-Leu
    5302. Salmonella enterica subsp. enterica serovar Typhimurium str. 35423 tRNA-Leu
    5303. Salmonella enterica subsp. enterica serovar Typhimurium str. 36618 tRNA-Leu
    5304. Salmonella enterica subsp. enterica serovar Typhimurium str. 798 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5305. Salmonella enterica subsp. enterica serovar Typhimurium str. 86-0368 tRNA-Leu
    5306. Salmonella enterica subsp. enterica serovar Typhimurium str. 95799 tRNA-Leu
    5307. Salmonella enterica subsp. enterica serovar Typhimurium str. 98346 tRNA-Leu
    5308. Salmonella enterica subsp. enterica serovar Typhimurium str. AZ 057 tRNA-Leu
    5309. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1153 tRNA-Leu
    5310. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1158 tRNA-Leu
    5311. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1277 tRNA-Leu
    5312. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1283 tRNA-Leu
    5313. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1288 tRNA-Leu
    5314. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 tRNA-Leu
    5315. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-2059 tRNA-Leu
    5316. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 tRNA-Leu
    5317. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5318. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 tRNA-Leu
    5319. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 tRNA-Leu
    5320. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000648 tRNA-Leu
    5321. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000653 tRNA-Leu
    5322. Salmonella enterica subsp. enterica serovar Typhimurium str. D23580 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5323. Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5324. Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5325. Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5326. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4_delta.ramA::kan tRNA-Leu
    5327. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4 tRNA-Leu
    5328. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5329. Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 tRNA-Leu
    5330. Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5331. Salmonella enterica subsp. enterica serovar Typhimurium str. ST1489 tRNA-Leu
    5332. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4581 tRNA-Leu
    5333. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4/74 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5334. Salmonella enterica subsp. enterica serovar Typhimurium str. STm10 tRNA-Leu
    5335. Salmonella enterica subsp. enterica serovar Typhimurium str. STm11 tRNA-Leu
    5336. Salmonella enterica subsp. enterica serovar Typhimurium str. STm12 tRNA-Leu
    5337. Salmonella enterica subsp. enterica serovar Typhimurium str. STm1 tRNA-Leu
    5338. Salmonella enterica subsp. enterica serovar Typhimurium str. STm2 tRNA-Leu
    5339. Salmonella enterica subsp. enterica serovar Typhimurium str. STm3 tRNA-Leu
    5340. Salmonella enterica subsp. enterica serovar Typhimurium str. STm4 tRNA-Leu
    5341. Salmonella enterica subsp. enterica serovar Typhimurium str. STm5 tRNA-Leu
    5342. Salmonella enterica subsp. enterica serovar Typhimurium str. STm6 tRNA-Leu
    5343. Salmonella enterica subsp. enterica serovar Typhimurium str. STm7 tRNA-Leu
    5344. Salmonella enterica subsp. enterica serovar Typhimurium str. STm8 tRNA-Leu
    5345. Salmonella enterica subsp. enterica serovar Typhimurium str. STm9 tRNA-Leu
    5346. Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5347. Salmonella enterica subsp. enterica serovar Typhimurium str. U288 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5348. Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5349. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 tRNA-Leu
    5350. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 tRNA-Leu
    5351. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 tRNA-Leu
    5352. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 tRNA-Leu
    5353. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 tRNA-Leu
    5354. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5355. Salmonella enterica subsp. enterica serovar Typhimurium tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5356. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN001921 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5357. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN004345 tRNA-Leu
    5358. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- tRNA-Leu
    5359. Salmonella enterica subsp. enterica serovar Typhimurium var. Copenhagen str. 0084 tRNA-Leu
    5360. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,[5],12:i:- tRNA-Leu
    5361. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,5,12:i:- tRNA-Leu
    5362. Salmonella enterica subsp. enterica serovar Typhi str. 404ty tRNA-Leu
    5363. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000626 tRNA-Leu
    5364. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000628 tRNA-Leu
    5365. Salmonella enterica subsp. enterica serovar Typhi str. CT18 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5366. Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5367. Salmonella enterica subsp. enterica serovar Typhi str. STH2370 tRNA-Leu
    5368. Salmonella enterica subsp. enterica serovar Typhi str. Ty21a tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5369. Salmonella enterica subsp. enterica serovar Typhi str. Ty2 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5370. Salmonella enterica subsp. enterica serovar Typhisuis str. CFSAN000654 tRNA-Leu
    5371. Salmonella enterica subsp. enterica serovar Typhisuis tRNA-Leu(tag)
    5372. Salmonella enterica subsp. enterica serovar Typhi tRNA-Leu(tag)
    5373. Salmonella enterica subsp. enterica serovar Tyresoe tRNA-Leu
    5374. Salmonella enterica subsp. enterica serovar Uganda str. R8-3404 tRNA-Leu
    5375. Salmonella enterica subsp. enterica serovar Uganda tRNA-Leu
    5376. Salmonella enterica subsp. enterica serovar Ughelli tRNA-Leu
    5377. Salmonella enterica subsp. enterica serovar Ullevi tRNA-Leu
    5378. Salmonella enterica subsp. enterica serovar Umbilo tRNA-Leu
    5379. Salmonella enterica subsp. enterica serovar Uppsala tRNA-Leu
    5380. Salmonella enterica subsp. enterica serovar Urbana str. ATCC 9261 tRNA-Leu
    5381. Salmonella enterica subsp. enterica serovar Urbana str. R8-2977 tRNA-Leu
    5382. Salmonella enterica subsp. enterica serovar Urbana tRNA-Leu
    5383. Salmonella enterica subsp. enterica serovar Uzaramo tRNA-Leu
    5384. Salmonella enterica subsp. enterica serovar Vaertan tRNA-Leu
    5385. Salmonella enterica subsp. enterica serovar Vancouver tRNA-Leu
    5386. Salmonella enterica subsp. enterica serovar Vejle tRNA-Leu
    5387. Salmonella enterica subsp. enterica serovar Veneziana tRNA-Leu
    5388. Salmonella enterica subsp. enterica serovar Victoria tRNA-Leu
    5389. Salmonella enterica subsp. enterica serovar Vinohrady tRNA-Leu
    5390. Salmonella enterica subsp. enterica serovar Virchow str. SVQ1 tRNA-Leu
    5391. Salmonella enterica subsp. enterica serovar Virchow tRNA-Leu
    5392. Salmonella enterica subsp. enterica serovar Virginia str. SA19971529 tRNA-Leu
    5393. Salmonella enterica subsp. enterica serovar Virginia tRNA-Leu
    5394. Salmonella enterica subsp. enterica serovar Vitkin tRNA-Leu
    5395. Salmonella enterica subsp. enterica serovar Volkmarsdorf tRNA-Leu
    5396. Salmonella enterica subsp. enterica serovar Vom tRNA-Leu
    5397. Salmonella enterica subsp. enterica serovar Vuadens tRNA-Leu
    5398. Salmonella enterica subsp. enterica serovar Wagenia tRNA-Leu
    5399. Salmonella enterica subsp. enterica serovar Wandsworth str. A4-580 tRNA-Leu
    5400. Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 tRNA-Leu
    5401. Salmonella enterica subsp. enterica serovar Wandsworth tRNA-Leu
    5402. Salmonella enterica subsp. enterica serovar Wangata tRNA-Leu
    5403. Salmonella enterica subsp. enterica serovar Warnow tRNA-Leu
    5404. Salmonella enterica subsp. enterica serovar Washington tRNA-Leu
    5405. Salmonella enterica subsp. enterica serovar Wa tRNA-Leu
    5406. Salmonella enterica subsp. enterica serovar Waycross tRNA-Leu
    5407. Salmonella enterica subsp. enterica serovar Wedding tRNA-Leu
    5408. Salmonella enterica subsp. enterica serovar Welikade tRNA-Leu
    5409. Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 tRNA-Leu
    5410. Salmonella enterica subsp. enterica serovar Weltevreden str. 2007-60-3289-1 tRNA-Leu
    5411. Salmonella enterica subsp. enterica serovar Weltevreden tRNA-Leu(tag)
    5412. Salmonella enterica subsp. enterica serovar Wentworth tRNA-Leu
    5413. Salmonella enterica subsp. enterica serovar Weslaco str. 247K tRNA-Leu
    5414. Salmonella enterica subsp. enterica serovar Weslaco tRNA-Leu
    5415. Salmonella enterica subsp. enterica serovar Westhampton tRNA-Leu
    5416. Salmonella enterica subsp. enterica serovar Weston tRNA-Leu
    5417. Salmonella enterica subsp. enterica serovar Weybridge tRNA-Leu
    5418. Salmonella enterica subsp. enterica serovar Widemarsh tRNA-Leu
    5419. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000656 tRNA-Leu
    5420. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000657 tRNA-Leu
    5421. Salmonella enterica subsp. enterica serovar Wien tRNA-Leu
    5422. Salmonella enterica subsp. enterica serovar Wilhelmsburg tRNA-Leu
    5423. Salmonella enterica subsp. enterica serovar Winterthur tRNA-Leu
    5424. Salmonella enterica subsp. enterica serovar Woodhull tRNA-Leu
    5425. Salmonella enterica subsp. enterica serovar Woodinville tRNA-Leu
    5426. Salmonella enterica subsp. enterica serovar Worthington str. ATCC 9607 tRNA-Leu
    5427. Salmonella enterica subsp. enterica serovar Worthington str. BCH-3008 tRNA-Leu
    5428. Salmonella enterica subsp. enterica serovar Worthington str. BCH-3194 tRNA-Leu
    5429. Salmonella enterica subsp. enterica serovar Worthington str. BCH-4719 tRNA-Leu
    5430. Salmonella enterica subsp. enterica serovar Worthington str. BCH-5715 tRNA-Leu
    5431. Salmonella enterica subsp. enterica serovar Worthington str. BCH-7253 tRNA-Leu
    5432. Salmonella enterica subsp. enterica serovar Worthington tRNA-Leu
    5433. Salmonella enterica subsp. enterica serovar Wyldegreen tRNA-Leu
    5434. Salmonella enterica subsp. enterica serovar Yolo tRNA-Leu
    5435. Salmonella enterica subsp. enterica serovar Yoruba tRNA-Leu
    5436. Salmonella enterica subsp. enterica serovar Yovokome str. S-1850 tRNA-Leu
    5437. Salmonella enterica subsp. enterica serovar Yovokome tRNA-Leu
    5438. Salmonella enterica subsp. enterica serovar Zaiman tRNA-Leu
    5439. Salmonella enterica subsp. enterica serovar Zanzibar tRNA-Leu
    5440. Salmonella enterica subsp. enterica tRNA-Leu(tag)
    5441. Salmonella enterica subsp. houtenae serovar 1,40:z4,z32:- tRNA-Leu
    5442. Salmonella enterica subsp. houtenae serovar 16:z4,z32:- tRNA-Leu
    5443. Salmonella enterica subsp. houtenae serovar 18:z36,z38:- tRNA-Leu
    5444. Salmonella enterica subsp. houtenae serovar 21:z4,z23:- tRNA-Leu
    5445. Salmonella enterica subsp. houtenae serovar 40:z4,z24:- tRNA-Leu
    5446. Salmonella enterica subsp. houtenae serovar 40:z4,z32:- tRNA-Leu
    5447. Salmonella enterica subsp. houtenae serovar 41:z4,z23:- tRNA-Leu
    5448. Salmonella enterica subsp. houtenae serovar 43:z4 tRNA-Leu
    5449. Salmonella enterica subsp. houtenae serovar 43:z4,z23:- tRNA-Leu
    5450. Salmonella enterica subsp. houtenae serovar 43:z4,z32:- tRNA-Leu
    5451. Salmonella enterica subsp. houtenae serovar 44:z36,[z38]:- tRNA-Leu
    5452. Salmonella enterica subsp. houtenae serovar 44:z36[z38]:- tRNA-Leu
    5453. Salmonella enterica subsp. houtenae serovar 44:z4,z23:- tRNA-Leu
    5454. Salmonella enterica subsp. houtenae serovar 44:z4,z24:- tRNA-Leu
    5455. Salmonella enterica subsp. houtenae serovar 45:g,z51:- tRNA-Leu
    5456. Salmonella enterica subsp. houtenae serovar 48:g,z51:- tRNA-Leu
    5457. Salmonella enterica subsp. houtenae serovar 48:z4,z32:- tRNA-Leu
    5458. Salmonella enterica subsp. houtenae serovar 50:g,z51:- str. 01-0133 tRNA-Leu
    5459. Salmonella enterica subsp. houtenae serovar 50:g,z51:- tRNA-Leu
    5460. Salmonella enterica subsp. houtenae serovar 50:z4,z23:- tRNA-Leu
    5461. Salmonella enterica subsp. houtenae serovar 53:z4,z23:- tRNA-Leu
    5462. Salmonella enterica subsp. houtenae serovar Houten tRNA-Leu(tag)
    5463. Salmonella enterica subsp. houtenae serovar O:11:g,z25:- tRNA-Leu
    5464. Salmonella enterica subsp. houtenae str. ATCC BAA-1581 tRNA-Leu
    5465. Salmonella enterica subsp. houtenae str. CFSAN000552 tRNA-Leu
    5466. Salmonella enterica subsp. houtenae str. CFSAN000557 tRNA-Leu
    5467. Salmonella enterica subsp. houtenae tRNA-Leu(tag)
    5468. Salmonella enterica subsp. indica serovar 41:b:1,7 tRNA-Leu
    5469. Salmonella enterica subsp. indica serovar 45:a:e,n,x tRNA-Leu
    5470. Salmonella enterica subsp. indica serovar 6,14,25:z10:1,(2),7 str. 1121 tRNA-Leu
    5471. Salmonella enterica subsp. indica serovar Marseille tRNA-Leu
    5472. Salmonella enterica subsp. indica tRNA-Leu(tag)
    5473. Salmonella enterica subsp. salamae serovar 18:z10:z6 tRNA-Leu
    5474. Salmonella enterica subsp. salamae serovar 30:1,z28:z6 tRNA-Leu
    5475. Salmonella enterica subsp. salamae serovar 42:f,g,t:-- tRNA-Leu
    5476. Salmonella enterica subsp. salamae serovar 42:r:- tRNA-Leu
    5477. Salmonella enterica subsp. salamae serovar 42:z:1,5 tRNA-Leu
    5478. Salmonella enterica subsp. salamae serovar 47:a:1,5 tRNA-Leu
    5479. Salmonella enterica subsp. salamae serovar 47:b:1,5 tRNA-Leu
    5480. Salmonella enterica subsp. salamae serovar 48:d:z6 tRNA-Leu
    5481. Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K tRNA-Leu
    5482. Salmonella enterica subsp. salamae serovar 56:b:[1,5] tRNA-Leu
    5483. Salmonella enterica subsp. salamae serovar 56:z10:e,n,x str. 1369-73 tRNA-Leu
    5484. Salmonella enterica subsp. salamae serovar 57:z29:z42 tRNA-Leu
    5485. Salmonella enterica subsp. salamae serovar 58:a:- tRNA-Leu
    5486. Salmonella enterica subsp. salamae serovar 58:d:z6 tRNA-Leu
    5487. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 str. 00-0163 tRNA-Leu
    5488. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 tRNA-Leu
    5489. Salmonella enterica subsp. salamae serovar 60:g,m,t:z6 tRNA-Leu
    5490. Salmonella enterica subsp. salamae serovar 6,7:m,t:- tRNA-Leu
    5491. Salmonella enterica subsp. salamae serovar Greenside tRNA-Leu(tag)
    5492. Salmonella enterica subsp. salamae serovar Sofia tRNA-Leu
    5493. Salmonella enterica subsp. salamae serovar Springs tRNA-Leu
    5494. Salmonella enterica subsp. salamae str. CFSAN000559 tRNA-Leu
    5495. Salmonella enterica subsp. salamae tRNA-Leu(tag)
    5496. Salmonella enterica subsp. VII serovar 1,40:g,z51:-- tRNA-Leu
    5497. Salmonella enterica subsp. VII serovar 40:z4,z24:[z39] tRNA-Leu
    5498. Salmonella enterica subsp. VII str. CFSAN000554 tRNA-Leu
    5499. Salmonella enterica tRNA-Leu(tag)
    5500. Salmonella sp. 32010201201800099SM tRNA-Leu
    5501. Salmonella sp. 32010601-2015-00010-FB-01-SM-01 tRNA-Leu
    5502. Salmonella sp. 32010601-2015-00137-FB-01-SM-01 tRNA-Leu
    5503. Salmonella sp. 32010601201600049SM tRNA-Leu
    5504. Salmonella sp. 32010601201600067SM tRNA-Leu
    5505. Salmonella sp. 32010601201800023SM tRNA-Leu
    5506. Salmonella sp. 32010601201800030SM tRNA-Leu
    5507. Salmonella sp. 32011103201800031SM tRNA-Leu
    5508. Salmonella sp. 32011103201800106SM tRNA-Leu
    5509. Salmonella sp. 32011401201800036SM tRNA-Leu
    5510. Salmonella sp. 32011401-201800074SM tRNA-Leu
    5511. Salmonella sp. 32011501201800079SM tRNA-Leu
    5512. Salmonella sp. 32011602201600097SM tRNA-Leu
    5513. Salmonella sp. 32011602201600105SM tRNA-Leu
    5514. Salmonella sp. 32011602201800010SM tRNA-Leu
    5515. Salmonella sp. 32011602201800014SM tRNA-Leu
    5516. Salmonella sp. 32011801201800027SM tRNA-Leu
    5517. Salmonella sp. 32020114201800008SM tRNA-Leu
    5518. Salmonella sp. 32020201-2017-00050-FB-01-SM-01 tRNA-Leu
    5519. Salmonella sp. 32020210201800012SM tRNA-Leu
    5520. Salmonella sp. 32020301-2015-00098-FB-01-SM-01 tRNA-Leu
    5521. Salmonella sp. 32020501-2015-00069-FB-01-SM-01 tRNA-Leu
    5522. Salmonella sp. 32020501-2019-00039 tRNA-Leu
    5523. Salmonella sp. 32020501-2019-00040 tRNA-Leu
    5524. Salmonella sp. 32020501-2019-00041 tRNA-Leu
    5525. Salmonella sp. 32020501-2019-00044 tRNA-Leu
    5526. Salmonella sp. 32020501-2019-00050 tRNA-Leu
    5527. Salmonella sp. 32020501-2019-00052 tRNA-Leu
    5528. Salmonella sp. 32020509201800054SM tRNA-Leu
    5529. Salmonella sp. 32020509201800068SM tRNA-Leu
    5530. Salmonella sp. 32020512-2019-00017 tRNA-Leu
    5531. Salmonella sp. 32020614-2019-00048 tRNA-Leu
    5532. Salmonella sp. 32021105201800037SM tRNA-Leu
    5533. Salmonella sp. 32031101201600128SM tRNA-Leu
    5534. Salmonella sp. 3203110320150095SM tRNA-Leu
    5535. Salmonella sp. 3203110320150106SM tRNA-Leu
    5536. Salmonella sp. 32031103201600220SM tRNA-Leu
    5537. Salmonella sp. 32031103201600241SM tRNA-Leu
    5538. Salmonella sp. 32031103201600284SM tRNA-Leu
    5539. Salmonella sp. 32031103201600383SM tRNA-Leu
    5540. Salmonella sp. 3203110320160044 tRNA-Leu
    5541. Salmonella sp. 3203110320160052 tRNA-Leu
    5542. Salmonella sp. 3203110320160127 tRNA-Leu
    5543. Salmonella sp. 3203110320160165 tRNA-Leu
    5544. Salmonella sp. 3203110320160211 tRNA-Leu
    5545. Salmonella sp. 32031103-2018-00083-FB-01-SM-01 tRNA-Leu
    5546. Salmonella sp. 32031103-2018-0023-FB-01-SM-01 tRNA-Leu
    5547. Salmonella sp. 32040202-2015-00022-FB-01-SM-01 tRNA-Leu
    5548. Salmonella sp. 32040203201700040FB01SM01 tRNA-Leu
    5549. Salmonella sp. 32040203201700113FB01SM01 tRNA-Leu
    5550. Salmonella sp. 32040203-2019-00004 tRNA-Leu
    5551. Salmonella sp. 32040203-2019-00032 tRNA-Leu
    5552. Salmonella sp. 32040203-2019-00058 tRNA-Leu
    5553. Salmonella sp. 32040203-2019-00061 tRNA-Leu
    5554. Salmonella sp. 32040203-2019-00097 tRNA-Leu
    5555. Salmonella sp. 32040203-2019-00118 tRNA-Leu
    5556. Salmonella sp. 32040203-2019-00127 tRNA-Leu
    5557. Salmonella sp. 32040203-2019-00133 tRNA-Leu
    5558. Salmonella sp. 32040203-2019-00159 tRNA-Leu
    5559. Salmonella sp. 32040203-2019-00173 tRNA-Leu
    5560. Salmonella sp. 32040209201700048FB01SM01 tRNA-Leu
    5561. Salmonella sp. 32048101-2015-00023-GS-01-SM-01 tRNA-Leu
    5562. Salmonella sp. 32048101-2015-00025-GS-01-SM-01 tRNA-Leu
    5563. Salmonella sp. 32058101201500184GS-01-SM-01 tRNA-Leu
    5564. Salmonella sp. 32070006-2019-00075 tRNA-Leu
    5565. Salmonella sp. 32070301201500052SM tRNA-Leu
    5566. Salmonella sp. 32070601201500089SM tRNA-Leu
    5567. Salmonella sp. 32070601201800144SM tRNA-Leu
    5568. Salmonella sp. 32080201-2017-00039-FB-01-SM-01 tRNA-Leu
    5569. Salmonella sp. 32081101-2017-00024-FB-01-SM-01 tRNA-Leu
    5570. Salmonella sp. 32082101201600294FB01SM01 tRNA-Leu
    5571. Salmonella sp. 32082101-2017-00322-FB-01-SM-01 tRNA-Leu
    5572. Salmonella sp. 32082101-2019-00528 tRNA-Leu
    5573. Salmonella sp. 32090202-2015-00079-FB-01-SM-01 tRNA-Leu
    5574. Salmonella sp. 32100201201700021SM tRNA-Leu
    5575. Salmonella sp. 32100201201700044SM tRNA-Leu
    5576. Salmonella sp. 32100201201700098SM tRNA-Leu
    5577. Salmonella sp. 32100201201700099SM tRNA-Leu
    5578. Salmonella sp. 32100201201700133SM tRNA-Leu
    5579. Salmonella sp. 32100202201700047SM tRNA-Leu
    5580. Salmonella sp. 32100202201700100SM tRNA-Leu
    5581. Salmonella sp. 32101201-2018-00131-FB-01-SM-01 tRNA-Leu
    5582. Salmonella sp. 32118201201500025SM tRNA-Leu
    5583. Salmonella sp. 32120201201500036SM tRNA-Leu
    5584. Salmonella sp. 32120201201600049SM tRNA-Leu
    5585. Salmonella sp. 32120201201600070SM tRNA-Leu
    5586. Salmonella sp. 32120201201700095FB-01-SM-01 tRNA-Leu
    5587. Salmonella sp. 32120201201700135FB-01-SM-01 tRNA-Leu
    5588. Salmonella sp. 32120201201700237FB-01-SM-01 tRNA-Leu
    5589. Salmonella sp. 32120202201500105SM tRNA-Leu
    5590. Salmonella sp. 32120202201500174SM tRNA-Leu
    5591. Salmonella sp. 32120202201600072SM tRNA-Leu
    5592. Salmonella sp. 32120202201600097SM tRNA-Leu
    5593. Salmonella sp. 32120202201600158SM tRNA-Leu
    5594. Salmonella sp. 32120203201500024SM tRNA-Leu
    5595. Salmonella sp. 32120203201700065FB-01-SM-01 tRNA-Leu
    5596. Salmonella sp. 32130201201500050SM tRNA-Leu
    5597. Salmonella sp. 32130201-2017-00038SM tRNA-Leu
    5598. Salmonella sp. 32132402-2017-00107SM tRNA-Leu
    5599. Salmonella sp. 3DZ2-4SM tRNA-Leu
    5600. Salmonella sp. D5-9891 tRNA-Leu
    5601. Salmonella sp. gx-f7 tRNA-Leu
    5602. Salmonella sp. gx-f9 tRNA-Leu
    5603. Salmonella sp. HMSC13B08 tRNA-Leu
    5604. Salmonella sp. hn-f5 tRNA-Leu
    5605. Salmonella sp. hn-h2 tRNA-Leu
    5606. Salmonella sp. hn-h4 tRNA-Leu
    5607. Salmonella sp. HNK130 tRNA-Leu
    5608. Salmonella sp. JS051105201500009SM tRNA-Leu
    5609. Salmonella sp. S13 tRNA-Leu
    5610. Salmonella sp. SAL-007 tRNA-Leu
    5611. Salmonella sp. SAL-020 tRNA-Leu
    5612. Salmonella sp. SAL-045 tRNA-Leu
    5613. Salmonella sp. SCFS4 tRNA-Leu
    5614. Salmonella sp. sc-h43 tRNA-Leu
    5615. Salmonella sp. SJTUF14076 tRNA-Leu
    5616. Salmonella sp. SJTUF14146 tRNA-Leu
    5617. Salmonella sp. SJTUF14152 tRNA-Leu
    5618. Salmonella sp. SJTUF14154 tRNA-Leu
    5619. Salmonella sp. SJTUF14170 tRNA-Leu
    5620. Salmonella sp. SJTUF14178 tRNA-Leu
    5621. Salmonella sp. SJTUF14523 tRNA-Leu
    5622. Salmonella sp. SJTUF15034 tRNA-Leu
    5623. Salmonella sp. SSDFZ54 tRNA-Leu
    5624. Salmonella sp. SSDFZ69 tRNA-Leu
    5625. Salmonella sp. XN2 tRNA-Leu
    5626. Salmonella sp. zj-f100 tRNA-Leu
    5627. Salmonella sp. zj-f50 tRNA-Leu
    5628. Salmonella sp. zj-f54 tRNA-Leu
    5629. Salmonella sp. zj-f60 tRNA-Leu
    5630. Salmonella sp. zj-f78 tRNA-Leu
    5631. Salmonella sp. zj-f95 tRNA-Leu
    5632. Scandinavium goeteborgense tRNA-Leu
    5633. Serratia ficaria tRNA-Leu(tag)
    5634. Serratia fonticola tRNA-Leu
    5635. Serratia liquefaciens tRNA-Leu(tag)
    5636. Serratia marcescens BIDMC 44 tRNA-Leu
    5637. Serratia marcescens BIDMC 50 tRNA-Leu
    5638. Serratia marcescens BIDMC 80 tRNA-Leu
    5639. Serratia marcescens BIDMC 81 tRNA-Leu
    5640. Serratia marcescens EGD-HP20 tRNA-Leu
    5641. Serratia marcescens SM39 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5642. Serratia marcescens subsp. marcescens ATCC 13880 tRNA-Leu
    5643. Serratia marcescens subsp. marcescens Db11 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5644. Serratia marcescens tRNA-Leu
    5645. Serratia marcescens tRNA-Leu
    5646. Serratia marcescens tRNA-Leu(tag)
    5647. Serratia marcescens VGH107 tRNA-Leu
    5648. Serratia marcescens WW4 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5649. Serratia nematodiphila DZ0503SBS1 tRNA-Leu
    5650. Serratia nematodiphila tRNA_Leu_TAG
    5651. Serratia odorifera DSM 4582 tRNA-Leu
    5652. Serratia odorifera tRNA-Leu
    5653. Serratia rubidaea tRNA-Leu(tag)
    5654. Serratia sp. 2880STDY5682894 tRNA-Leu(tag)
    5655. Serratia sp. 2880STDY5682895 tRNA-Leu(tag)
    5656. Serratia sp. ATCC 39006 tRNA-Leu
    5657. Serratia sp. EWG9 tRNA-Leu
    5658. Serratia sp. FDAARGOS_506 tRNA-Leu
    5659. Serratia sp. FGI94 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5660. Serratia sp. FS14 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5661. Serratia sp. HMSC15F11 tRNA-Leu
    5662. Serratia sp. HRI tRNA-Leu
    5663. Serratia sp. ISTD04 tRNA-Leu
    5664. Serratia sp. JKS000199 tRNA-Leu
    5665. Serratia sp. JUb9 tRNA-Leu
    5666. Serratia rhizosphaerae tRNA-Leu
    5667. Serratia sp. LS-1 tRNA-Leu
    5668. Serratia sp. MYb239 tRNA-Leu
    5669. Serratia sp. Nf2 tRNA-Leu
    5670. Serratia sp. NGAS9 tRNA-Leu
    5671. Serratia sp. OLAL2 tRNA-Leu
    5672. Serratia sp. OLBL1 tRNA-Leu
    5673. Serratia sp. OLCL1 tRNA-Leu
    5674. Serratia sp. OLDL1 tRNA-Leu
    5675. Serratia sp. OLEL1 tRNA-Leu
    5676. Serratia sp. OLFL2 tRNA-Leu
    5677. Serratia sp. OLHL2 tRNA-Leu
    5678. Serratia sp. OLIL2 tRNA-Leu
    5679. Serratia sp. OLJL1 tRNA-Leu
    5680. Serratia sp. OLLOLW30 tRNA-Leu
    5681. Serratia sp. OLMTLW26 tRNA-Leu
    5682. Serratia sp. OMLW3 tRNA-Leu
    5683. Serratia sp. OPWLW2 tRNA-Leu
    5684. Serratia sp. OPWLW3 tRNA-Leu
    5685. Serratia sp. OSPLW9 tRNA-Leu
    5686. Serratia sp. S119 tRNA-Leu
    5687. Serratia sp. S9 tRNA-Leu
    5688. Serratia sp. SCBI tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5689. Serratia sp. SRS-8-S-2018 tRNA-Leu
    5690. Serratia sp. SSNIH1 tRNA-Leu
    5691. Serratia sp. SSNIH2 tRNA-Leu
    5692. Serratia sp. SSNIH3 tRNA-Leu
    5693. Serratia sp. SSNIH4 tRNA-Leu
    5694. Serratia sp. SSNIH5 tRNA-Leu
    5695. Serratia sp. Tan611 Leu tRNA
    5696. Serratia sp. TEL tRNA-Leu
    5697. Serratia sp. TKO39 tRNA-Leu
    5698. Serratia sp. YC16 tRNA-Leu
    5699. Serratia surfactantfaciens tRNA-Leu
    5700. Serratia surfactantfaciens tRNA-Leu
    5701. Serratia ureilytica tRNA-Leu
    5702. Serratia ficaria tRNA-Leu
    5703. Shigella boydii 3594-74 tRNA-Leu
    5704. Shigella boydii 4444-74 tRNA-Leu
    5705. Shigella boydii 5216-82 tRNA-Leu
    5706. Shigella boydii 965-58 tRNA-Leu
    5707. Shigella boydii CDC 3083-94 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5708. Shigella boydii Sb227 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5709. Shigella boydii tRNA-Leu
    5710. Shigella dysenteriae 155-74 tRNA-Leu
    5711. Shigella dysenteriae 1617 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5712. Shigella dysenteriae 225-75 tRNA-Leu
    5713. Shigella dysenteriae Sd197 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5714. Shigella dysenteriae tRNA-Leu(tag)
    5715. Shigella flexneri 1235-66 tRNA-Leu
    5716. Shigella flexneri 1485-80 tRNA-Leu
    5717. Shigella flexneri 1a tRNA-Leu
    5718. Shigella flexneri 1b tRNA-Leu
    5719. Shigella flexneri 1c tRNA-Leu
    5720. Shigella flexneri 2002017 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5721. Shigella flexneri 2003036 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5722. Shigella flexneri 2747-71 tRNA-Leu
    5723. Shigella flexneri 2850-71 tRNA-Leu
    5724. Shigella flexneri 2930-71 tRNA-Leu
    5725. Shigella flexneri 2a str. 2457T tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5726. Shigella flexneri 2a str. 301 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5727. Shigella flexneri 2a tRNA-Leu(tag)
    5728. Shigella flexneri 2b tRNA-Leu(tag)
    5729. Shigella flexneri 3a tRNA-Leu
    5730. Shigella flexneri 3b tRNA-Leu
    5731. Shigella flexneri 4343-70 tRNA-Leu
    5732. Shigella flexneri 4c tRNA-Leu
    5733. Shigella flexneri 5a str. M90T tRNA-Leu
    5734. Shigella flexneri 5 str. 8401 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5735. Shigella flexneri 6603-63 tRNA-Leu
    5736. Shigella flexneri CCH060 tRNA-Leu
    5737. Shigella flexneri G1663 tRNA-Leu
    5738. Shigella flexneri K-1770 tRNA-Leu
    5739. Shigella flexneri K-218 tRNA-Leu
    5740. Shigella flexneri K-227 tRNA-Leu
    5741. Shigella flexneri K-272 tRNA-Leu
    5742. Shigella flexneri K-304 tRNA-Leu
    5743. Shigella flexneri K-315 tRNA-Leu
    5744. Shigella flexneri K-404 tRNA-Leu
    5745. Shigella flexneri K-671 tRNA-Leu
    5746. Shigella flexneri SFJ17B tRNA-Leu
    5747. Shigella flexneri Shi06HN006 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5748. Shigella flexneri tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5749. Shigella flexneri VA-6 tRNA-Leu
    5750. Shigella flexneri Y tRNA-Leu
    5751. Shigella sonnei 3226-85 tRNA-Leu
    5752. Shigella sonnei 4822-66 tRNA-Leu
    5753. Shigella sonnei 53G tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5754. Shigella sonnei Ss046 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5755. Shigella sonnei str. Moseley tRNA-Leu
    5756. Shigella sonnei tRNA-Leu(tag)
    5757. Shigella sp. FC1056 tRNA-Leu
    5758. Shigella sp. FC1139 tRNA-Leu
    5759. Shigella sp. FC1180 tRNA-Leu
    5760. Shigella sp. FC130 tRNA-Leu
    5761. Shigella sp. FC1544 tRNA-Leu
    5762. Shigella sp. FC1567 tRNA-Leu
    5763. Shigella sp. FC1655 tRNA-Leu
    5764. Shigella sp. FC1661 tRNA-Leu
    5765. Shigella sp. FC1708 tRNA-Leu
    5766. Shigella sp. FC1737 tRNA-Leu
    5767. Shigella sp. FC1967 tRNA-Leu
    5768. Shigella sp. FC2117 tRNA-Leu
    5769. Shigella sp. FC2125 tRNA-Leu
    5770. Shigella sp. FC2175 tRNA-Leu
    5771. Shigella sp. FC2383 tRNA-Leu
    5772. Shigella sp. FC2531 tRNA-Leu
    5773. Shigella sp. FC2833 tRNA-Leu
    5774. Shigella sp. FC3196 tRNA-Leu
    5775. Shigella sp. PAMC 28760 tRNA-Leu
    5776. Shigella sp. tRNA-Leu
    5777. Siccibacter turicensis tRNA-Leu
    5778. Sodalis praecaptivus tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5779. Sodalis sp. TME1 tRNA-Leu
    5780. Staphylococcus aureus tRNA-Leu
    5781. Streptococcus pneumoniae tRNA-Leu(tag)
    5782. Superficieibacter electus tRNA-Leu
    5783. synthetic Escherichia coli C321.deltaA tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5784. Tatumella citrea tRNA-Leu
    5785. Tatumella morbirosei tRNA-Leu
    5786. Tatumella ptyseos ATCC 33301 tRNA-Leu
    5787. Tatumella ptyseos tRNA-Leu(tag)
    5788. Tatumella sp. JGM100 tRNA-Leu
    5789. Tatumella sp. JGM130 tRNA-Leu
    5790. Tatumella sp. JGM82 tRNA-Leu
    5791. Tatumella sp. JGM91 tRNA-Leu
    5792. Tatumella sp. JGM94 tRNA-Leu
    5793. Trabulsiella guamensis ATCC 49490 tRNA-Leu
    5794. Trabulsiella odontotermitis tRNA-Leu
    5795. Vibrio parahaemolyticus tRNA-Leu
    5796. Vibrio vulnificus tRNA-Leu
    5797. Xenorhabdus beddingii tRNA-Leu
    5798. Xenorhabdus bovienii SS-2004 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5799. Xenorhabdus bovienii str. feltiae Florida tRNA-Leu
    5800. Xenorhabdus bovienii str. feltiae France tRNA-Leu
    5801. Xenorhabdus bovienii str. feltiae Moldova tRNA-Leu
    5802. Xenorhabdus bovienii str. Intermedium tRNA-Leu
    5803. Xenorhabdus bovienii str. Jollieti tRNA-Leu
    5804. Xenorhabdus bovienii str. kraussei Becker Underwood tRNA-Leu
    5805. Xenorhabdus bovienii str. kraussei Quebec tRNA-Leu
    5806. Xenorhabdus bovienii str. oregonense tRNA-Leu
    5807. Xenorhabdus bovienii str. puntauvense tRNA-Leu
    5808. Xenorhabdus bovienii tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5809. Xenorhabdus budapestensis tRNA-Leu
    5810. Xenorhabdus cabanillasii JM26 tRNA-Leu
    5811. Xenorhabdus doucetiae tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5812. Xenorhabdus eapokensis tRNA-Leu
    5813. Xenorhabdus ehlersii tRNA-Leu
    5814. Xenorhabdus griffiniae tRNA-Leu
    5815. Xenorhabdus hominickii tRNA-Leu
    5816. Xenorhabdus innexi tRNA-Leu
    5817. Xenorhabdus ishibashii tRNA-Leu
    5818. Xenorhabdus khoisanae tRNA-Leu
    5819. Xenorhabdus kozodoii tRNA-Leu
    5820. Xenorhabdus mauleonii tRNA-Leu
    5821. Xenorhabdus miraniensis tRNA-Leu
    5822. Xenorhabdus nematophila AN6/1 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5823. Xenorhabdus nematophila ATCC 19061 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5824. Xenorhabdus nematophila F1 tRNA-Leu
    5825. Xenorhabdus nematophila str. Anatoliense tRNA-Leu
    5826. Xenorhabdus nematophila str. Websteri tRNA-Leu
    5827. Xenorhabdus nematophila tRNA-Leu
    5828. Xenorhabdus poinarii G6 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    5829. Xenorhabdus poinarii tRNA-Leu
    5830. Xenorhabdus sp. 18 tRNA-Leu
    5831. Xenorhabdus sp. 38 tRNA-Leu
    5832. Xenorhabdus sp. 3 tRNA-Leu
    5833. Xenorhabdus sp. 42 tRNA-Leu
    5834. Xenorhabdus sp. 5 tRNA-Leu
    5835. Xenorhabdus sp. BG5 tRNA-Leu
    5836. Xenorhabdus sp. CUL tRNA-Leu
    5837. Xenorhabdus sp. DI tRNA-Leu
    5838. Xenorhabdus sp. Flor tRNA-Leu
    5839. Xenorhabdus sp. GDc328 tRNA-Leu
    5840. Xenorhabdus sp. KJ12.1 tRNA-Leu
    5841. Xenorhabdus sp. KK7.4 tRNA-Leu
    5842. Xenorhabdus sp. M tRNA-Leu
    5843. Xenorhabdus sp. Vera tRNA-Leu
    5844. Xenorhabdus lircayensis tRNA-Leu
    5845. Xenorhabdus sp. ZM tRNA-Leu
    5846. Xenorhabdus stockiae tRNA-Leu
    5847. Xenorhabdus szentirmaii DSM 16338 tRNA-Leu
    5848. Xenorhabdus szentirmaii tRNA-Leu
    5849. Xenorhabdus thuongxuanensis tRNA-Leu
    5850. Xenorhabdus vietnamensis tRNA-Leu
    5851. Chimaeribacter californicus tRNA-Leu
    5852. Chimaeribacter arupi tRNA-Leu
    5853. Chimaeribacter coloradensis tRNA-Leu
    5854. Yokenella regensburgei ATCC 43003 tRNA-Leu
    5855. Yokenella regensburgei ATCC 49455 tRNA-Leu
    5856. Yokenella regensburgei tRNA-Leu(tag)
    5857. Zobellella denitrificans tRNA-Leu
    5858. Zobellella endophytica tRNA-Leu
    5859. Zobellella sp. CGMCC 1.18722 tRNA-Leu
    5860. Zobellella taiwanensis tRNA-Leu
    2D structure Publications New