Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-107-5p URS0000035FEE_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-107: Mmu-mir-107 is a murine miRNA that is involved in the regulation of various pathways, including the MAPK and FOXO pathways [PMC6833270]. It is one of the differentially expressed (DE) miRNAs that play a role in the regulation of PTGs in these pathways [PMC6833270]. Mmu-mir-107 is also one of the DE miRNAs with the highest degree in the network, indicating its importance in these pathways [PMC6833270]. Additionally, mmu-mir-107 has been found to have similar roles as mmu-miR-103 and mmu-miR-181a in regulating insulin sensitivity and promoting metastasis of colorectal cancer [PMC3937077]. Mmu-mir-107 shares its name with hsa-mir-107, a human miRNA, indicating orthology between these two species [PMC3731538]. In a study on DIO mice, mmu-mir-107 was found to be downregulated in DIO mice compared to DIO + LFD mice [PMC4571067]. Mmu-mir-107 has also been used as a target for qRT-PCR analysis using specific kits [PMC7847849]. Furthermore, LNA probes have been used to detect mmu-mir-107 expression [PMC4860119]. In Alzheimer's disease (AD), mmu-mir-107 has been found to be downregulated and involved in regulating BACE1 expression and disease progression [PMC6906698].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUUCUUUACAGUGUUGCCUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Cavia porcellus cpo-miR-107-5p
  2. Chiloscyllium plagiosum microRNA cpl-miR-107-5p
  3. Columba livia (rock pigeon) cli-miR-107-5p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-107-5p
  5. Gallus gallus (chicken) gga-miR-107-5p
  6. Macaca mulatta (Rhesus monkey) mml-miR-107-5p
  7. Oryctolagus cuniculus (rabbit) ocu-miR-107-5p
  8. Pteropus alecto (black flying fox) pal-miR-107a-5p
  9. Python bivittatus (Burmese python) pbv-miR-107-5p
  10. Salmo salar ssa-miR-107-5p
  11. Xenopus laevis (African clawed frog) xla-miR-107-5p
Publications