Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-483-5p URS000003575B_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (ENA, MalaCards, MirGeneDB, GeneCards, PSICQUIC, RefSeq, TarBase, miRBase, IntAct, LncBase). Described in 52 papers. Homo sapiens (human) hsa-miR-483-5p sequence is a product of hsa-miR-483-5p, MIR483, miR-483-5p, hsa-miR-483, miR-483 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 5-HTT, ABRA1, ABRAXAS, ABRAXAS1, ACDCR1, ACHAP, ACN9, ACO2, ACONM, ADIPOR1.

Interactions 5

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-483-5p interacts with:

Interaction id Participant Synonyms
EBI-16762887 intact:EBI-16762860 EBI-16762860 ENST00000265354.5 mrna_srf
URS000003575B_9606-1 P11831 P11831
URS000003575B_9606-2 P11831 P11831
URS000003575B_9606-0 P27361 P27361
URS000003575B_9606-3 P27361 P27361

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAGACGGGAGGAAAGAAGGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 3 other species