Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (miRBase, ENA, MirGeneDB, IntAct, PSICQUIC, LncBase, RefSeq, TarBase, GeneCards, MalaCards). Described in 56 papers. Homo sapiens (human) hsa-miR-483-5p sequence is a product of miR-483-5p, hsa-miR-483-5p, miR-483, MIR483, hsa-miR-483 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 5-HTT, ABRA1, ABRAXAS, ABRAXAS1, ACDCR1, ACHAP, ACN9, ACO2, ACONM, ADIPOR1.
According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-483-5p interacts with:
This sequence is found in {{ locations.length }} genome
Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
---|---|---|---|---|---|---|---|---|
Loading genome locations... | ||||||||
Failed to load data from server | ||||||||
No genome locations known | ||||||||
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AAGACGGGAGGAAAGAAGGGAG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.