Homo sapiens (human) hsa-miR-483-5p URS000003575B_9606

• 22 nucleotides
• 10 databases (ENA, GeneCards, IntAct, LncBase, MalaCards, miRBase, MirGeneDB, PSICQUIC, RefSeq, TarBase)
• Found in 4 species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (ENA, MalaCards, MirGeneDB, GeneCards, PSICQUIC, RefSeq, TarBase, miRBase, IntAct, LncBase). Described in 52 papers. Homo sapiens (human) hsa-miR-483-5p sequence is a product of hsa-miR-483-5p, MIR483, miR-483-5p, hsa-miR-483, miR-483 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 5-HTT, ABRA1, ABRAXAS, ABRAXAS1, ACDCR1, ACHAP, ACN9, ACO2, ACONM, ADIPOR1.

Interactions 5

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-483-5p interacts with:

Interaction id	Participant	Synonyms
EBI-16762887	intact:EBI-16762860	EBI-16762860 ENST00000265354.5 mrna_srf
URS000003575B_9606-1	P11831	P11831
URS000003575B_9606-2	P11831	P11831
URS000003575B_9606-0	P27361	P27361
URS000003575B_9606-3	P27361	P27361

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location	Chromosome	Start	End	Strand	Ensembl	UCSC	Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
Go to location loading browser Can't view - strange chromosome name	{{ location.chromosome }}	{{ location.start | number }}	{{ location.end | number }}	{{ location.strand == "1" ? "forward" : "reverse" }}	{{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }}	UCSC	100%	{{ location.identity * 100 | number:0 }}%

No genome locations found for this sequence. Learn more →

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

AAGACGGGAGGAAAGAAGGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

1. Gorilla gorilla (western gorilla) ggo-miR-483
2. Macaca mulatta Mml-Mir-483_5p (mature (co-guide))

Download

• FASTA
• JSON