Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gorilla gorilla. Annotated by 2 databases (RefSeq, miRBase). Gorilla gorilla (western gorilla) ggo-miR-483 sequence is a product of MIR483, ggo-miR-483, miR-483 genes.
This sequence is found in {{ locations.length }} genome
Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
---|---|---|---|---|---|---|---|---|
Loading genome locations... | ||||||||
Failed to load data from server | ||||||||
No genome locations known | ||||||||
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AAGACGGGAGGAAAGAAGGGAG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.