Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 10 secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 10 URS0000034D55_9606

Automated summary: This snoRNA sequence is 133 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (IntAct, RefSeq, ENA, GeneCards, snOPY, Ensembl/GENCODE, Ensembl, HGNC, snoDB, Rfam). Described in 15 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (SNORA64, RF00264). Homo sapiens (human) small nucleolar RNA, H/ACA box 10 sequence is a product of SNORA10, ENSG00000206811.1, ACA10 snoRNA genes. Found in the human reference genome.

Interactions 1

According to IntAct, Homo sapiens (human) small nucleolar RNA, H/ACA box 10 interacts with:

Interaction id Participant Synonyms
EBI-16227430 URS000032B6B6_9606 EBI-16223110 URS000032B6B6_9606 snrna u1-1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGUCUCUCAGCUCCGCUUAACCACACGGGUCCAGUGUGUGCUUGGCGUGUUUUCAGGGAGGCAGAGAAAGGCUCUCCUAAUGCACGACAGACCCGCCCAGAAUGGCCUCUCUGUUCCUAGGAGUGCGACAAUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 3 other species

    2D structure New