Automated summary: This snoRNA sequence is 133 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (Rfam, ENA, RefSeq, GeneCards, IntAct, Ensembl, snoDB, snOPY, HGNC). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (SNORA64, RF00264). Homo sapiens (human) small nucleolar RNA, H/ACA box 10 (SNORA10) sequence is a product of ENSG00000206811.1, ACA10 snoRNA, SNORA10 genes. Found in the Homo sapiens reference genome.
According to IntAct, Homo sapiens (human) small nucleolar RNA, H/ACA box 10 (SNORA10) interacts with:
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GGUCUCUCAGCUCCGCUUAACCACACGGGUCCAGUGUGUGCUUGGCGUGUUUUCAGGGAGGCAGAGAAAGGCUCUCCUAAUGCACGACAGACCCGCCCAGAAUGGCCUCUCUGUUCCUAGGAGUGCGACAAUU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.