Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1289 URS0000030489_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-1289: Hsa-mir-1289 is a miRNA that has been studied in various contexts. In one study, mimics of hsa-mir-1289 were cotransfected with reporter plasmids, and it was found that hsa-mir-1289 could bind to the 3'UTR region of the MTHFR gene [PMC4505847]. Furthermore, hsa-mir-1289 was found to significantly suppress luciferase expression in the presence of a specific haplotype [PMC4505847]. In another study, survival analysis showed that hsa-mir-1289 was one of the key miRNAs associated with a significantly lower overall survival rate [PMC8544338]. The expression levels of hsa-mir-1289 were also found to be downregulated in certain cells [PMC6235008]. These findings suggest that hsa-mir-1289 may play a role in gene regulation and could potentially be used as a prognostic marker. However, further research is needed to fully understand the functional significance of hsa-mir-1289 and its potential implications in various diseases and conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGUCCAGGAAUCUGCAUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Equus caballus (horse) eca-miR-1289
  2. Pan troglodytes ptr-miR-1289
  3. Pongo pygmaeus ppy-miR-1289
Publications