Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1193 URS000002F2FA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1193: Hsa-mir-1193 is a microRNA marker that has been identified in various studies related to cancer, including acute myeloid leukemia (AML) and lung cancer [PMC6595612] [PMC6826455]. It has been found to play a role in regulating AML, along with other microRNAs such as hsa-mir-520b, hsa-mir-520e, hsa-mir-320a, hsa-mir-449a, hsa-mir-429, hsa-mir-107, and hsa-mir-137 [PMC6595612]. Hsa-mir-1193 has been shown to target PAG1 and is involved in regulating carcinogenesis and tumor progression [PMC6826455]. It has also been identified as one of the miRNAs that intersect with circRNA-predicted target genes in AML patients [PMC10145421]. In addition, it has been used in experiments involving the insertion of double-stranded DNA into a luciferase vector for further analysis [PMC7393494]. Hsa-miR-1193 has also been found to be downregulated in certain conditions such as multiple myeloma (MMVP) [PMC4881574] and is predicted to interact with CCDC167 through miRWalk and IPA databases [PMC7906182]. Overall, these studies highlight the potential role of hsa-miR-1193 as a marker for cancer progression and its involvement in various cellular processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGAUGGUAGACCGGUGACGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla ggo-miR-1193 (MIR1193)
  2. Gorilla gorilla ggo-miR-1193
  3. Ovis aries oar-miR-1193-5p
  4. Pongo pygmaeus (Bornean orangutan) ppy-miR-1193
Publications