Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-105a URS000002E182_9615

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Canis lupus familiaris. Annotated by 2 databases (RefSeq, miRBase). Canis lupus familiaris (dog) cfa-miR-105a sequence is a product of cfa-miR-105a, MIR105A, miR-105a, miR-105 genes. Found in the dog reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCAAAUGCUCAGACUCCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 59 other species

    1. Gorilla gorilla ggo-miR-105
    2. Homo sapiens (human) microRNA miR-105
    3. Lagothrix lagotricha lla-miR-105
    4. Macaca mulatta microRNA mir-105-1
    5. Macaca nemestrina (pig-tailed macaque) mne-miR-105
    6. Pan paniscus (pygmy chimpanzee) ppa-miR-105
    7. Pan troglodytes ptr-miR-105
    8. Pongo pygmaeus (Bornean orangutan) microRNA mir-105-1
    9. Saguinus labiatus (red-chested mustached tamarin) sla-miR-105
    10. Sus scrofa ssc-miR-105-1
    Publications New