Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-105a URS000002E182_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAAAUGCUCAGACUCCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Gorilla gorilla gorilla ggo-miR-105 (MIR105)
  2. Gorilla gorilla ggo-miR-105
  3. Homo sapiens microRNA miR-105
  4. Lagothrix lagotricha (brown woolly monkey) lla-miR-105
  5. Macaca mulatta microRNA mir-105-1
  6. Macaca nemestrina mne-miR-105
  7. Pan paniscus (pygmy chimpanzee) ppa-miR-105
  8. Pan troglodytes ptr-miR-105
  9. Pongo pygmaeus (Bornean orangutan) microRNA mir-105-1
  10. Saguinus labiatus sla-miR-105
  11. Sus scrofa (pig) ssc-miR-105-1
Publications