Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA miR-105 URS000002E182_9606

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Homo sapiens. Annotated by 2 databases (GeneCards, ENA). Described in 2 papers. Homo sapiens (human) microRNA miR-105 sequence is a product of miR-105, MIR105-1, MIR105-2, 105 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCAAAUGCUCAGACUCCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Canis lupus familiaris cfa-miR-105a
    2. Gorilla gorilla (western gorilla) ggo-miR-105
    3. Lagothrix lagotricha lla-miR-105
    4. Macaca mulatta microRNA mir-105-1
    5. Macaca nemestrina (pig-tailed macaque) mne-miR-105
    6. Pan paniscus ppa-miR-105
    7. Pan troglodytes (chimpanzee) ptr-miR-105
    8. Pongo pygmaeus microRNA mir-105-1
    9. Saguinus labiatus sla-miR-105
    10. Sus scrofa ssc-miR-105-1