Pan paniscus (pygmy chimpanzee) ppa-miR-105 URS000002E182_9597

• 20 nucleotides
• 3 databases (ENA, miRBase, RefSeq)
• Found in 11 other species
• 24 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UCAAAUGCUCAGACUCCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

1. Canis lupus familiaris (dog) cfa-miR-105a
2. Gorilla gorilla gorilla ggo-miR-105 (MIR105)
3. Gorilla gorilla ggo-miR-105
4. Homo sapiens microRNA miR-105
5. Lagothrix lagotricha (brown woolly monkey) lla-miR-105
6. Macaca mulatta microRNA mir-105-1
7. Macaca nemestrina mne-miR-105
8. Pan troglodytes ptr-miR-105
9. Pongo pygmaeus (Bornean orangutan) microRNA mir-105-1
10. Saguinus labiatus sla-miR-105
11. Sus scrofa (pig) ssc-miR-105-1

Publications Download

• FASTA
• JSON