v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 571 (LINC00571) URS000002CA7E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00571: LINC00571 is a long non-coding RNA (lncRNA) that has been identified as one of the ten independent prognostic m6A-related lncRNAs in a study on triple-negative breast cancer (TNBC) patients [PMC8183938]. The study found that LINC00571, along with CIRBP-AS1 and HOXB-AS1, were risk factors for TNBC patients, while SAMD12-AS1, BVES-AS1, LINC00593, MIR205HG, ANKRD10-IT1, SUCLG2-AS1, and BLACAT1 were considered protective factors [PMC8183938]. Another study also identified LINC00571 as one of the 81 differentially expressed prognostic-related lncRNAs in TNBC patients [PMC9334800]. Additionally, a 10-m6A-related lncRNA signature that included LINC00571 was found to be predictive of prognostic risk in TNBC patients [PMC9843365]. The study established a prognostic score risk model using this signature and showed that patients with lower scores had better overall survival [PMC9843365]. Finally, LINC00571 was also identified as one of the 17 lncRNAs associated with TNBC in another study [PMC9307901]. These findings highlight the potential significance of LINC00571 as a prognostic marker for TNBC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCAAAAGAUAAAAACAAGCAAGAAAGCAAACAAAUAAAAGUAACAACAAAAUUUAAGAACCCCUUGCAUGGAAGGAUGCUUAUUUCCUCUGGACUGAAAGAUGGCAUCAGAAGUGGGAUCUAAAGUAAAGCUUCUAACAAUCCCCAUGAGCACUGAGUGACCAAGCAAGGUACACGCCAGGCCUGUUCUGUCUGUUGCUCUCACAGAGGAGCUGGGGAUCGUGGAGGUUCAUGACAGGAUGAAAAGAAACCUGAGAAGCACUCUUGAAGAGAGGUUUCUGAAUAACUUUCGAAUCAUAUCAUUUGGACUGGAUAACAGUGUUGAGGCAGAGAAGUUUCAUAAUCUGCCUAAGAUCAUUGCAUUUACAAGUGACGAACCCACUGCACAAAUUUUGGCAAUGACAGAAACUUCAUCUGCAUUGGCUUCGGCAAAGCAGAAAUUUAUUAGCUUACAAGGCUGUACAGGAAACAUGGCUGGGGAGGUCUCAGGAAACUUACAAUCAUGGUGGAAAGUGAAGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications