Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Actinoplanes friuliensis DSM 7358 5S ribosomal RNA secondary structure diagram

Actinoplanes friuliensis DSM 7358 5S ribosomal RNA URS000002C3B2_1246995

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCGGUGGUUAUAGCGGAGGGGAAACGCCCGGUCUCAUUUCGAACCCGGAAGCUAAGCCCUCCAGCGCCGAUGGUACUGCACUCGGGAGGGUGUGGGAGAGUAGGACGCCGCCGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Actinoplanes friuliensis 5S rRNA
2D structure Publications