5S ribosomal RNA from Oryctolagus cuniculus (PDB 6ZVK, chain d2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

5S ribosomal RNA from Oryctolagus cuniculus (PDB 6ZVK, chain d2) URS000002B0D5_9986

120 nucleotides
1 database (PDBe)
Found in 4 other species
22 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUCUACGGCCAUACCACCCUGAACGCGCCCGAUCUCGUCUGAUCUCGGAAGCUAAGCAGGGUCGGGCCUGGUUAGUACUUGGAUGGGAGACCGCCUGGGAAUACCGGGUGCUGUAGGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Sus scrofa 5S ribosomal RNA from Sus scrofa (PDB 3J7Q, chain 7)
Bos taurus 5S rRNA
Homo sapiens 5S rRNA
Mus musculus 5S rRNA

2D structure

Publications