Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 74 (SNORD74) URS000002951F_9606

Automated summary: This snoRNA sequence is 72 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (ENA, MalaCards, RefSeq, GeneCards, HGNC, snoDB, IntAct). Matches 1 Rfam family (SNORD74, RF00284). Homo sapiens (human) small nucleolar RNA, C/D box 74 (SNORD74) sequence is a product of SNORD74 gene. Found in the human reference genome.

Interactions 1

According to IntAct, Homo sapiens (human) small nucleolar RNA, C/D box 74 (SNORD74) interacts with:

Interaction id Participant Synonyms
EBI-16398289 URS0000ABD82A_9606 EBI-15183729 HGNC:37659 URS0000ABD82A_9606 rrna 28s human

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CUGCCUCUGAUGAAGCCUGUGUUGGUAGGGACAUCUGACAGUAAUGAUGAAUGCCAACCGCUCUGAUGGUGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    Publications New