Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Takifugu rubripes (torafugu) fru-miR-184 URS0000029225_31033

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Takifugu rubripes. Annotated by 2 databases (RefSeq, miRBase). Described in 2 papers. Takifugu rubripes (torafugu) fru-miR-184 sequence is a product of mir184, fru-miR-184, miR-184 genes. Found in the torafugu reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGACGGAGAACUGAUAAGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 73 other species

    1. Anopheles gambiae aga-miR-184
    2. Branchiostoma floridae (Florida lancelet) bfl-miR-184-3p
    3. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-2314
    4. Gadus morhua gmo-miR-184-3p
    5. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-184b
    6. Maylandia zebra (zebra mbuna) mze-miR-184b
    7. Mus musculus Mus_musculus piRNA piR-mmu-8284712
    8. Neolamprologus brichardi nbr-miR-184b
    9. Oreochromis niloticus (Nile tilapia) oni-miR-184b
    10. Oryzias latipes (Japanese medaka) ola-miR-184-3p
    11. Pundamilia nyererei pny-miR-184b
    12. Python bivittatus (Burmese python) pbv-miR-184-3p
    13. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63139
    14. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-184
    15. Xenopus laevis xla-miR-184
    Publications New