Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Caenorhabditis elegans piwi-interacting RNA 21ur-14510 URS0000028E6D_6239

Automated summary: This piRNA sequence is 21 nucleotides long and is found in Caenorhabditis elegans. Annotated by 3 databases (PirBase, RefSeq, WormBase). Caenorhabditis elegans piwi-interacting RNA 21ur-14510 sequence is a product of 21ur-14510 gene. Found in the Caenorhabditis elegans reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUAUAUCAUCAUUCAGAUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.