Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00000284F1_559292

Automated summary: This snoRNA sequence is 172 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (ENA, SGD, RefSeq, IntAct). Described in 38 papers. Matches 1 Rfam family (snR45, RF01266). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR45 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 4

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

IntAct ID Participant Synonyms
EBI-16631838 P08518 B150 D6W2K8 DNA-directed RNA polymerase II 140 kDa polypeptide EBI-15767 P08518 Q12738 Q7Z9Y0 RPB150 RPB2 RPO22 YOR151C rpb2_yeast
EBI-16631862 P38996 D6W3H8 EBI-11776 HMD1 NAB3 P38996 Q07034 YPL190C nab3_yeast
EBI-16631883 P53617 D6W0U2 EBI-12228 N0868 NRD1 P53617 YNL251C nrd1_yeast
EBI-11620082 Q05022 D6W054 EBI-16011 FMI1 Q05022 RRP5 Ribosomal RNA-processing protein 5 U3 small nucleolar RNA-associated protein RRP5 YM9959.11C YMR229C rrp5_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUGACCUUCCAAGUUUUUAAAAGAAUACGAUGAUAUUAUUUGCGUUUCAAAUCGAACAAUUCUUCUCGGAGCGAUCUGAGGUUUUAAUGGAGAUAGCGGUUCCUGCGCAACCCAUUGAUCUUGUUACAUUCUUAAGAAUGACAAGGACGCUUUUAUAAAAUUCUGAUUCUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 87 other species

    1. Saccharomyces cerevisiae (baker's yeast) SNR45
    2. Saccharomyces cerevisiae EC1118 SNR45
    3. Saccharomyces cerevisiae Kyokai no. 7 K7_snR45
    4. Saccharomyces cerevisiae P283 SNR45
    5. Saccharomyces cerevisiae P301 SNR45
    6. Saccharomyces cerevisiae R008 SNR45
    7. Saccharomyces cerevisiae R103 SNR45
    8. Saccharomyces cerevisiae YJM1083 SNR45
    9. Saccharomyces cerevisiae YJM1129 SNR45
    10. Saccharomyces cerevisiae YJM1133 SNR45
    11. Saccharomyces cerevisiae YJM1190 SNR45
    12. Saccharomyces cerevisiae YJM1199 SNR45
    13. Saccharomyces cerevisiae YJM1202 SNR45
    14. Saccharomyces cerevisiae YJM1208 SNR45
    15. Saccharomyces cerevisiae YJM1242 SNR45
    16. Saccharomyces cerevisiae YJM1244 SNR45
    17. Saccharomyces cerevisiae YJM1248 SNR45
    18. Saccharomyces cerevisiae YJM1250 SNR45
    19. Saccharomyces cerevisiae YJM1252 SNR45
    20. Saccharomyces cerevisiae YJM1273 SNR45
    21. Saccharomyces cerevisiae YJM1304 SNR45
    22. Saccharomyces cerevisiae YJM1311 SNR45
    23. Saccharomyces cerevisiae YJM1326 SNR45
    24. Saccharomyces cerevisiae YJM1332 SNR45
    25. Saccharomyces cerevisiae YJM1336 SNR45
    26. Saccharomyces cerevisiae YJM1338 SNR45
    27. Saccharomyces cerevisiae YJM1341 SNR45
    28. Saccharomyces cerevisiae YJM1342 SNR45
    29. Saccharomyces cerevisiae YJM1355 SNR45
    30. Saccharomyces cerevisiae YJM1356 SNR45
    31. Saccharomyces cerevisiae YJM1381 SNR45
    32. Saccharomyces cerevisiae YJM1383 SNR45
    33. Saccharomyces cerevisiae YJM1385 SNR45
    34. Saccharomyces cerevisiae YJM1386 SNR45
    35. Saccharomyces cerevisiae YJM1387 SNR45
    36. Saccharomyces cerevisiae YJM1389 SNR45
    37. Saccharomyces cerevisiae YJM1399 SNR45
    38. Saccharomyces cerevisiae YJM1400 SNR45
    39. Saccharomyces cerevisiae YJM1401 SNR45
    40. Saccharomyces cerevisiae YJM1402 SNR45
    41. Saccharomyces cerevisiae YJM1415 SNR45
    42. Saccharomyces cerevisiae YJM1417 SNR45
    43. Saccharomyces cerevisiae YJM1419 SNR45
    44. Saccharomyces cerevisiae YJM1433 SNR45
    45. Saccharomyces cerevisiae YJM1434 SNR45
    46. Saccharomyces cerevisiae YJM1439 SNR45
    47. Saccharomyces cerevisiae YJM1443 SNR45
    48. Saccharomyces cerevisiae YJM1444 SNR45
    49. Saccharomyces cerevisiae YJM1447 SNR45
    50. Saccharomyces cerevisiae YJM1450 SNR45
    51. Saccharomyces cerevisiae YJM1460 SNR45
    52. Saccharomyces cerevisiae YJM1477 SNR45
    53. Saccharomyces cerevisiae YJM1479 SNR45
    54. Saccharomyces cerevisiae YJM1526 SNR45
    55. Saccharomyces cerevisiae YJM1527 SNR45
    56. Saccharomyces cerevisiae YJM1549 SNR45
    57. Saccharomyces cerevisiae YJM1573 SNR45
    58. Saccharomyces cerevisiae YJM1574 SNR45
    59. Saccharomyces cerevisiae YJM1592 SNR45
    60. Saccharomyces cerevisiae YJM189 SNR45
    61. Saccharomyces cerevisiae YJM193 SNR45
    62. Saccharomyces cerevisiae YJM195 SNR45
    63. Saccharomyces cerevisiae YJM244 SNR45
    64. Saccharomyces cerevisiae YJM270 SNR45
    65. Saccharomyces cerevisiae YJM271 SNR45
    66. Saccharomyces cerevisiae YJM326 SNR45
    67. Saccharomyces cerevisiae YJM428 SNR45
    68. Saccharomyces cerevisiae YJM450 SNR45
    69. Saccharomyces cerevisiae YJM451 SNR45
    70. Saccharomyces cerevisiae YJM453 SNR45
    71. Saccharomyces cerevisiae YJM456 SNR45
    72. Saccharomyces cerevisiae YJM470 SNR45
    73. Saccharomyces cerevisiae YJM541 SNR45
    74. Saccharomyces cerevisiae YJM554 SNR45
    75. Saccharomyces cerevisiae YJM555 SNR45
    76. Saccharomyces cerevisiae YJM627 SNR45
    77. Saccharomyces cerevisiae YJM681 SNR45
    78. Saccharomyces cerevisiae YJM682 SNR45
    79. Saccharomyces cerevisiae YJM683 SNR45
    80. Saccharomyces cerevisiae YJM969 SNR45
    81. Saccharomyces cerevisiae YJM975 SNR45
    82. Saccharomyces cerevisiae YJM978 SNR45
    83. Saccharomyces cerevisiae YJM981 SNR45
    84. Saccharomyces cerevisiae YJM984 SNR45
    85. Saccharomyces cerevisiae YJM987 SNR45
    86. Saccharomyces cerevisiae YJM990 SNR45
    87. Saccharomyces cerevisiae YJM993 SNR45
    88. Saccharomyces cerevisiae YJM996 SNR45