Automated summary: This antisense RNA sequence is 89 nucleotides long and is found in Caenorhabditis elegans. Annotated by 2 databases (RefSeq, WormBase). Caenorhabditis elegans antisense RNA K08F4.15 sequence is a product of K08F4.15 gene. Found in the Caenorhabditis elegans reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UCGGCCCAUGUCAAAUCAUCACCAACCAGGAAACCGGAUUUACUUCUAAGUAAUAUUUUAUUAAGAGCAAUAAAGUAAUUCUUGAUUGC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.