Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Vector YCy2508 tRNA-Asp secondary structure diagram

Vector YCy2508 tRNA-Asp URS0000022919_2995581

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAACAAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Saccharomyces cerevisiae (baker's yeast) tRNA-OTHER
  2. Saccharomyces cerevisiae S288C tRNA-Asp
  3. Saccharomyces cerevisiae Sigma1278b tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
  4. Saccharomyces cerevisiae W303 tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
2D structure