Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-155-5p URS0000021B51_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 7 databases (PirBase, ENA, RefSeq, miRBase, LncBase, IntAct, TarBase). Mus musculus (house mouse) mmu-miR-155-5p sequence is a product of Mir155, mmu-miR-155-5p, mmu-miR-155, miR-155, miR-155-5p genes. Found in the Mus musculus reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including (P)RR, (alpha)1 subunit, (homologous Alu RNA binding protein), -14 gene, 0610005A07Rik, 0610006A03Rik, 0610006A11Rik, 0610006F02Rik, 0610006H08Rik, 0610006J14Rik.

Interactions 34

According to PSICQUIC and IntAct, Mus musculus (house mouse) mmu-miR-155-5p interacts with:

Interaction id Participant Synonyms
EBI-16752180 intact:EBI-16752162 EBI-16752162 ENSMUST00000053317.11 mrna_bdnf-1
EBI-16878352 intact:EBI-16878347 EBI-16878347 ENSMUST00000111356.7 mrna_nr1h3
EBI-16880999 intact:EBI-16881002 EBI-16881002 ENSMUST00000023507.12 mrna_gsk3b
EBI-16880996 intact:EBI-16881022 EBI-16881022 ENSMUST00000102564.10 mrna_arrb2
EBI-20559878 intact:EBI-20559866 EBI-20559866 ENSMUST00000172314.8 mrna_hbp1
URS0000021B51_10090-0 E9Q1A8 E9Q1A8
URS0000021B51_10090-18 E9Q1A8 E9Q1A8
URS0000021B51_10090-2 P09581 P09581
URS0000021B51_10090-1 P09581 P09581
URS0000021B51_10090-19 P09581 P09581
URS0000021B51_10090-3 P17433 P17433
URS0000021B51_10090-16 P17433 P17433
URS0000021B51_10090-4 P21237 P21237
URS0000021B51_10090-20 P21237 P21237
URS0000021B51_10090-5 P54841 P54841
URS0000021B51_10090-21 Q04207 Q04207
URS0000021B51_10090-6 Q04207 Q04207
URS0000021B51_10090-22 Q60855 Q60855
URS0000021B51_10090-7 Q60855 Q60855
URS0000021B51_10090-17 Q60929 Q60929
URS0000021B51_10090-8 Q61160 Q61160
URS0000021B51_10090-23 Q61160 Q61160
URS0000021B51_10090-9 Q62315 Q62315
URS0000021B51_10090-24 Q62315 Q62315
URS0000021B51_10090-10 Q91YI4 Q91YI4
URS0000021B51_10090-25 Q91YI4 Q91YI4
URS0000021B51_10090-11 Q9QUI0 Q9QUI0
URS0000021B51_10090-12 Q9QXE4 Q9QXE4
URS0000021B51_10090-26 Q9R0T8 Q9R0T8
URS0000021B51_10090-13 Q9R0T8 Q9R0T8
URS0000021B51_10090-14 Q9WV60 Q9WV60
URS0000021B51_10090-27 Q9WV60 Q9WV60
URS0000021B51_10090-28 Q9Z0Y9 Q9Z0Y9
URS0000021B51_10090-15 Q9Z0Y9 Q9Z0Y9

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUAAUGCUAAUUGUGAUAGGGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 1 other species

    1. Rattus norvegicus (Norway rat) rno-miR-155-5p
    Publications