Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) BSN antisense RNA 1 (BSN-AS1) URS0000021965_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

BSN-AS1: BSN-AS1 is a long non-coding RNA (lncRNA) that is expressed in T-helper cell subtypes (ThP, Th0, Th1, and Th2) and is associated with inflammatory bowel disease (IBD), celiac disease (CeD), psoriasis (PsCh), and ulcerative colitis (UC) [PMC4240855]. In addition to BSN-AS1, eight other lncRNAs were found to be specifically expressed in testis tissue: GRM7-AS3, ARHGAP26-AS1, KRBOX1-AS1, CACNA1C-IT3, AC012361.1, FGF14-IT1, AC012494.1, and GS1-24F4.2 [PMC8231607]. These lncRNAs were found to interact with miR-936 and miR-204-5p [PMC8231607]. The miRNAs miR-125a-5p, miR125b5p, miR5745p, miR936, and miR2045p, along with the associated lncRNAs GRM7AS3, ARHGAP26AS1, BSNAS, KRBOX, CACNA, AC012361, FGF14IT, AC012494.1, and GS1-24F4.2, have potential diagnostic applications in male infertility after SARS-CoV-2 infection [PMC8231607]. Specifically, these lncRNAs may serve as diagnostic markers for SARS-CoV-2 infection in infertile men [PMC9530275].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAGAGUAAUACGUGGGAGAAGGAGGCAUAGAGAAUAAAAAGAAACCAUGAUUCCUAUCCUGAAGAAGCUUAGAGUCUAGCUGAAGAAACAAGAUACUACAGAAUGAAAAAUCUUGAGAACAAAAUAAGCGAGGGUAAAGUAAUGCAAUGUGCGGUGGCUCACACCUGUAAUCCAGGCACUUUGGGAGGCAGAGGCAGGAGGAUCAUUUGAGGUCAGGAGUUCGAGACCUGCCUGACCAACAUGGUGAAACCCCAUCUCUACUGAAAAUAGUAAGAAUUGGCCAGGUGUGGUGGCGAACGCCUGUAAUCUCAGCUACUUGGGAGGCUGAGGCAGGAGAAUUGCUUGAACCCAGGAGGCGGAGGUUGCAGUAAGCCAAGACUGUGCCGCUGCACUCCAGCCUGGGCAACAGAGUGAGACUCCAUCUCAAAAUAAUUAAAUAAAUAAAUAAAAAUAAAACAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications