Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo heidelbergensis (Heidelberg man) tRNA-Pro secondary structure diagram

Homo heidelbergensis (Heidelberg man) tRNA-Pro URS000002176F_1425170

Automated summary: This tRNA sequence is 68 nucleotides long and is found in Homo heidelbergensis. Annotated by 1 database (ENA). Described in 1 paper. Has a conserved secondary structure or a structured region. Homo heidelbergensis (Heidelberg man) tRNA-Pro sequence is a product of TRNP gene.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAGAGAAUAGUUUAAAUUAGAAUCUUAGCUUUGGGUGCUAAUGGUGGAGUUAAAGACUUUUUCUCUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 2 other species

    1. Homo sapiens mitochondrially encoded tRNA-Pro (CCN)
    2. Homo sapiens neanderthalensis tRNA-Pro
    3. Homo sapiens subsp. 'Denisova' transfer RNA-Pro
    2D structure New