Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Enterobacter cloacae 5S rRNA secondary structure diagram

Enterobacter cloacae 5S rRNA URS000001FB40_550

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUGGCGGCUUUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Enterobacter asburiae 5S ribosomal RNA
  2. Enterobacteriaceae bacterium ATCC 29904 5S rRNA
  3. Enterobacter ludwigii 5S ribosomal RNA
  4. Erwinia amylovora NBRC 12687 = CFBP 1232 5S ribosomal RNA
  5. Erwinia billingiae 5S rRNA
  6. Erwinia billingiae Eb661 5S ribosomal RNA
  7. Erwinia pyrifoliae 5S rRNA
  8. Erwinia pyrifoliae Ep1/96 5S ribosomal RNA
  9. Erwinia sp. Ejp617 5S rRNA
  10. Erwinia tasmaniensis 5S rRNA
2D structure